Nano Domino Circuit

Abstract

Most of conventional molecular computing systems utilize inter-molecular reactions. However, since the concentration of molecules in solution is used as computing information, the computational speed and accuracy is limited due to the diffusion of molecules.

Here, we proposed a novel intra-molecular computing system based on a Domino-liked origami. [1-2]. Our origami is composed of a six-helix bundle [3] and side chains. The six-helix bundle serves as the base for computation. The side chains have a bridge-liked shape and serve as dominos in the system. The dominos are fixed to the base by holder strands and can be released from the base by releaser strands. We implemented the Domino effect to transmit the state of each domino by utilizing restriction strand displacement reaction and restriction enzymes[4].

Using this domino system, we can realize complicated molecular computation, which is faster and more accurate than that is realized by conventional method.

Project

Purpose

How to represent and transmit information is essentially important in molecular computation. For example, voltage at semiconductor transistors represents the digits in electronic calculators. In DNA computing, we try to realize information processing by utilizing hybridization of DNA molecules.

Most of existing DNA computing systems [5], molecular elements execute computation by inter-molecular reaction (e.g. hybridization between DNA strands) [6], in which the computing process depends on concentration of each DNA molecule, and the information transmission among them is done through simple diffusion (fig. 1). As a result, the speed of computing usually becomes slow. When the concentration becomes too low to achieve inter-molecular reactions, the computing process would be limited.

Moreover, these systems work in vitro, however, operation in vivo such as in human blood vessel is difficult or almost impossible, because necessary concentration of molecules cannot be achieved in such environments.

In order to overcome the limitation of inter-molecular computation, we aimed to develop a system which is able to compute in wider range of environments, by introducing intra-molecular computation. [7] In the proposed system, all the necessary reactions for computation are implemented on a single macromolecule, therefore not depends on the concentration.

Fig.1 Comparison of Nano Domino circuit and Normal DNA logic circuit

Idea

A domino effect is the cumulative effect produced when one event sets off a chain of similar events. [8] Domino effect is used as an analogy to a falling row of dominoes. It typically refers to a linked sequence of events where the time between successive events is relatively small. It can be used literally (an observed series of actual collisions) or metaphorically (causal linkages within systems).

Inspired by domino effect, we proposed a method to execute computation by chain reaction among Domino-like structures on a single DNA origami base [9] (fig. 2). This method solves problems of existing molecular computing (e.g. it requires certain level of concentration, slow computing speed, etc.) originated from its inter-molecular reaction.

Our domino system is able to create complicated calculations without difficulty by merging or splitting the chains of dominos. For instance, a domino which has two holder strands receiving domino transmission from two chains can be used as AND or OR gate. In a similar way, the computational result of one domino chain can be delivered to two lines downstream. By aligning the dominoes on the origami base, arbitrary computation is able to be realized.

Fig. 2a Domino toppling model
Fig. 2b Domino toppling to logical gate

Project Goal & Achievement

Fig. 3 Flowchart of our project

Our goal is to realize the inter-molecular computation by DNA origami domino. We divide the goal into 5 sub-goals (Fig. 3).

  1. To design the DNA origami domino by caDNAno2.
  2. To simulate the behavior of DNA origami domino using a physics engine.
  3. To confirm the shape of the DNA origami domino by AFM.
  4. To verify the strand displacement reaction and restriction enzyme reaction.
  5. To evaluate the domino toppling on DNA origami.

Actually, we have achieved almost all sub-goals now. The designed DNA origami domino is constructed correctly. The strand displacement reaction and restriction enzyme reaction took place as we expected.

Future

Information transmission by dominoes on a single molecule has potential to realize various computing systems in wide range of environments. Concentration of DNA molecules for conventional inter-molecular computing must be kept at certain level, however it is difficult to maintain the concentration in living organisms such as in human body. Our Nano domino circuit does not have this difficulty in principle, because all the computation is completed on a single molecule. [10]

For example, different bio-markers of cancer can be used as triggers for the domino reaction. Nano domino circuit can evaluate the combination of bio-markers by logic gate operation, and diagnose whether the disease is serious or not in its earliest stage.

Moreover, we can integrate it into Nano robot that treats cancer at the same time. [11] The nano robot’s capsule containing antitumor agents can be programmed to open only when a certain combination of factors is detected [12]. This kind of technology realizes minimally invasive remedy with almost no side effects. In addition to this, Nano domino circuit is metal free, thus more biocompatible.

As stated above, Nano domino circuit has potential of realizing new technology everyone dreams of.

Design

Mechanism

We designed a DNA origami structure, which is composed of a six-helix bundle and side chains (Fig. 4). The six-helix bundle serves as the base for computation, whose length is about 150 nm. The side chains have a bridge-liked (parallelogram) shape and serve as dominos in the system.

Fig. 4 The structure and detail of DNA Origami

To limit the Brownian motion of the domino, a single-stranded DNA (holder) is attached to the left side of the domino, which can hybridize with the complementary strand attached to the base. To release the domino, another single-stranded DNA (releaser) is attached to its right side. Releaser strands can react with the holder strands of adjacent domino. The domino effect can be triggered by an initiator strand, which can hybridize only with the first domino (Fig. 5).

Start reaction

Fig. 5 Domino toppling process on DNA Origami

Structure

As fig. 6 and fig. 7 show, we realized the domino effect by utilizing both strand displacement reaction and restriction enzymes. At the initial condition, all the dominoes are fixed on the origami base by holders. Importantly, the releasers cannot reach the holders of adjacent dominoes due to the geometrical constraints in this condition. When the initiator strand is added to the solution, strand displacement reaction releases the first domino. Then the releaser of the first domino becomes able to hybridize with the holder of the next domino, which makes the recognition site for a restriction enzyme. Followed by cleavage of the holder, the second domino become released, and the same reaction occurs again to the third one. This chain reaction would continue until it reaches the last domino. By using this mechanism, the state can transmit in a determined direction like domino toppling.

Fig. 6 Design of domino by caDNAno2 [13]
Fig. 7 CanDo simulation image [14]

Experiment

The flow of the experiment

The experiment is divided into 4 steps. (fig .8)

Fig. 8 Flowchart for our experiment

After observing Domino structure and confirming the elements of Domino toppling, we confirmed whether Domino toppling can work on DNA origami structure in actually.

A.Observation of DNA origami

In this experiment, we confirmed whether DNA origami could be generated from M13 scaffold and several staple strands.

Result of experiment A

Fig.9 Result of the electrophoresis

From the left lane, Ladder, M13, DNA origami. In the DNA origami lane, the band shifted to upper comparing to the M13 lane. This indicates the structure changed. From this result, we confirmed staple strands connect to scaffold.

Next, we observed DNA origami structure by AFM. Following three figures are the results of AFM observation.

Fig. 10 AFM observation of DNA origami and length analysis
Table. 1 Calculation of deviation
Mean value (nm) Theoretical value (nm) Deviation (％)
118.178067 150.857143 21.66

We measured the actual length of DNA origami from Fig. 10. First, we measured the length of blue lines and calculated the mean value. table. 1 shows the calculation results. The deviation between theoretical value and actual measurement was 21.66%. We also measured the mean value of width in the same way. It was 17.45 nm.

Fig. 11 (A) AFM observation of domino structure (B) Enlarged image
Fig. 12 Confirmation of domino structures by height analysis

Fig. 12 shows the height distribution obtained from Fig. 11 (B) (yellow line). Peaks are circled. We observed 4 peaks though the one in left end is saturated. This is the evidence that we succeeded in constructing dominoes structure on DNA origami.

B.Confirmation of chain reaction

In this experiment, we confirmed the chain reaction to release a constraint of the first Domino.

Experiment B-1

At first, we did an experiment to confirm whether the chain reaction could work as expected using our designed DNA sequences.

Fig. 13 The chain reaction of experiment B-1

The experimental scheme is shown in Fig. 13. In this experiment, three DNA strands, DNA 1,2 and 3 were used. At first, DNA3 was in a condition to hybridize with DNA2 by annealing previously. Then DNA1 was added there and a hybridization happened from a part of B as a toehold. Subsequently, a toehold exchange happened in a part of A. Finally, when a reaction was completely finished, DNA3 was separated by DNA2.

Result of experiment B-1

Fig. 14 Result of experiment B-1 (A)Electrophoresis result of DNA2 + DNA3 (B)Electrophoresis result after strand displacement (C)Analysis of fluorescence intensity (D)Calculation of strand displacement efficiency

In the Fig. 14(A) with only complementary strands, the band of DNA3 was unobserved. But in the Fig. 14(B) including DNA 1 which causes chain reaction, the band of DNA3 appeared and the main band shifted upward. Fig. 14(C) shows the distribution of fluorescence intensity along the vertical line drawn between the A and B on electrophoresis results. Blue and red curves derived from Fig. 14(A) and Fig. 14(B), respectively. According to the figures, we succeeded in confirming the strand displacement reaction.

Next, we calculated the efficiency of the reaction. First, we calculated the mean values of fluorescence intensity at 4 areas boxed in white in Fig. 14(A) and (B). Area 1 and 4 are the background we need to subtract from Area 2 and 3, respectively. Fig. 14(D) shows the process and the result of calculation. We obtained about 95% of efficiency.

Experiment B-2

From the result of experiment B-1, we could verify a validity of our designed sequences, so next we did experiment B-2 using sequences which take account of a behavior of Dominos topologically. 　

Fig. 15 A scheme of experiment B-2

The experimental scheme is shown in Fig. 15. Same as experiment B-1, DNA 2 and 3 are hybridized by pre-annealing, but these two strands become circular. Here, DNA 1 connects to this cyclic structure and induces the chain reaction same as experiment B-1, then it changes to straight.

Result of experiment B-2

Fig. 16 Result of experiment B-2 (A)Electrophoresis result of DNA2 + DNA3 (B)Electrophoresis result after strand displacement (C)Analysis of fluorescence intensity (D)Calculation of strand displacement efficiency

Here, we conducted the same analysis as Experiment B-1.

In Fig. 16(A) with only complementary strands, the band of DNA 3 wasn’t observed. But in Fig. 16(B) including DNA 1 which causes chain reaction, the main band shifted downward in spite of the larger molecular weight. This I because the linear structures after strand displacement reaction were easier to move. According to the figures, we succeeded in confirming the strand displacement reaction again. In Fig. 16(A), the reason why we didn’t put Area 2 just under Area1 is that there was a smear around Area 1. Compared to Experiment B-1, the efficiency of reaction was decreased to 70.3%. To improve this problem, we need to prepare high concentrated DNA1.

　 In the lane [2+3] with only complementary strands, the band of DNA 3 was unobserved. But in the lane [(2+3)+1] including DNA 1 which causes chain reaction, the band of DNA the main band shifted upper. This indicates the structure changed. From this result, even though in a situation assumed to react on DNA origami structure, we can conclude that our designed sequences can react as expected.

C. Confirmation of cutting DNA strand by restriction enzyme

We conducted 3 major experiments related to the restriction enzymes.

  1. Checking the operation of restriction enzyme which cuts off the releaser from the holder under the buffer solution containing TAE and MgCl2, as well as the synthesis of the origami dominoes.
  2. Confirming the enzyme reaction at double helices bound on DNA origami.

Experiment C-1 Operation check of restriction enzyme

We checked whether the restriction enzyme cut off the recognition site under the same buffer condition for DNA origami annealing. (Fig. 17)

Fig. 17 The concept of enzyme reaction.
　　

Method C-1

We made the sample whose a composition of Table 2. An enzyme EcoR1 was added after annealing.

Table 2. The composition of experiment C-1
Solution Concentration
DNA 200 nM
Buffer 1×TAE
MgCl2 12.5 mM
EcoR1 0.75 U/μL
　　

Result of experiment C-1

Fig. 18 Electrophoresis of double stranded DNA before and after enzyme reaction.

Fig. 18 shows the result. There are two lanes, each left and right lane correspond to double stranded DNA before and after enzyme reaction. From this result, when the enzyme is added, we cannot observe the band of double stranded DNA which we can confirm without the enzyme. So, we consider that the cleaving reaction shown in Fig. 17 is taken by enzyme.

Experiment C-2 Confirmation of the cleaving reaction on domino

In experiment C-2, in order to confirm domino toppling caused by enzyme’s cleaving reaction on domino, we did experiments using DNA strands whose one ends are hybridized and the opposite side has recognition site.

Fig. 19 Restriction Enzyme of Experiment C-2

The present DNA strands are fixed at the end (Fig. 19). This reproduce the holder and the releaser on domino. In a solution, structure① and structure② are coexistent. When an enzyme is put into there, structure④ is separated from structure① and structure③ whose molecular weight become smaller is generated.

Method C-2

At first, we prepared samples. Concentrations of DNA strand and buffer are same as experiment C-1. Next, after annealing following condition of experiment C-1, samples were incubated with an enzyme and reacted. After enzyme reaction, the enzyme was devitalized at 80℃ for 15 minutes. The reaction times were ten ways, 0 (devitalized immediately), 15, 30 seconds, 1, 2, 4, 8, 16, 32 and 64 minutes. And the reaction temperature is 37℃. In addition to these conditions, we prepared a sample which was reacted at 25℃ for 60 minutes. We confirmed these samples by electrophoresis.

Result of experiment C-2

Fig. 20 Electrophoresis of Experiment C-2
Fig. 21 Rate of Band 1 and Band 3
Fig. 22 Incubation result at 25℃ and 37 ℃

From Fig.20, we investigated the relationship between reaction time and fluorescence intensity. Horizontal axis represents reaction time. Vertical axis represents the ratio of fluorescence intensity. Left axis represents the ratio of band 1 to the total intensity of band 1 to 4. Right axis represents the ratio of band 2. (Fig. 21) The initial state shown in Fig. 19 appeared to band 1. Band 3 represents the shorter DNA caused by enzyme reaction. As time proceeds, fluorescence intensity of band 1 weakened, on the other hand band 3 brightened. The result also shows the peak of reaction time is about 40min. This indicates that longer reaction time is effective for the operation of enzyme. According to Fig. 22,, the bands of the samples incubated at 25℃ and 37℃ appeared the same, which indicated that temperature is not main factor that influences on the restriction enzyme.

Experiment D Confirmation of DNA Origami Domino

We conducted the experiment to confirm that if the chain reaction of DNA domino take place as we expected. As the domino reaction processing, the holder and releaser are cleaved by restriction enzymes, and the fluorescence is quenched.

Based on this principle, we prepared the samples of DNA origami dominoes, which are equipped with fluorescence molecules on the releaser strands of the first (sample 1), second (sample 2), and third (sample 3) dominoes respectively. Then, we mixed the samples of DNA domino with the input strands and restriction enzyme (Eco R1). We conducted electrophoresis for 3 times by adjusting the concentration of input strands and restrcition enzymes, incubation time etc.

Fig. 23 Sketch of DNA domino with fluorescence molecules

Experiment 1

We prepared 75 nM fluorescent domino samples and incubated these samples for 15 min, 30 min, 60 min respectively. Then, we conducted electrophoresis (Fig. 24) and measured the fluorescence intensity (Fig. 25).

Fig. 24　Electrophoresis result of Experiment 1
Fig. 25　Fluorescence intensity of Experiment 1

According to the experimental results, the fluorescence intensity of sample 1 decreased more than others, which indicates that the reaction of the first domino processed more than the second and the third one. Moreover, we confirmed that the reaction of DNA dominoes processed more as the incubation time become longer.

Experiment 2

We prepared 75 nM fluorescent domino samples and incubated these samples for 15 min, 30 min, 60 min and 120 min respectively. Then, we conducted electrophoresis (Fig. 26) and measured the fluorescence intensity (Fig. 27) of DNA domino with a fluorescence molecule on the first releaser.

Fig. 26　 Electrophoresis result of Experiment 2
Fig. 27　Fluorescence intensity of Experiment 2

Experiment 3

We prepared 60 nM fluorescent domino samples and incubated these samples for 15 min, 30 min, 60 min and 120 min respectively. Then, we conducted electrophoresis and measured the fluorescence intensity. However, the reaction didn't processed as we expected. We considered that the chain reaction of DNA domino takes place at a relatively high concentration of DNA origami.

Simulation

Fig. 28 Simulation of the behavior of the domino of by Unity [15]

To predict the behavior of dominoes, we are developing a simulator using a game engine called Unity. The Unity provides a framework to model and simulate entities that are subject to physical laws. In our simulation, a double stranded structure of DNA is regarded as a rigid rod, while a single stranded DNA segment is treated as a flexible rope. So far, we programmed a code with C# and added the feature of Brownian motion to the Unity by applying random speed in each frame.

The result of preliminary simulation is shown in Fig. 5. Here, Brownian motion of the domino is successfully simulated. Simulation results with different conditions will be reflected in the geometry of domino structures. We also plan to quantitatively/statistically analyze experimental data in order to estimate the kinetics of domino reactions.

Discussion

Implementation of domino reaction

Molecular logic gates can be implemented on our DNA Origami Domino. Since a domino part can move randomly in the solution, the releaser strands have possibility to touch to a domino on another line. Using this property, we can realize a state transmission system defined on multiple chains of dominoes, which can be applied to construct various logic gate network on a single DNA origami. For instance, if there are two input chains join at a domino, and the domino needs two different releasers, an AND gate can be realized. If the domino can be released by either of the input chains, an OR gate can be realized.

Fig. 29 Domino arranged in six rows
Fig. 30 AND gate
Fig. 31 OR Gate
Fig. 32 Making logic gate in one DNA Origami

Material & Method

Experiment A Observation of DNA Origami

We mixed 91 staple strands with M13 (7249 nt). The concentration of M13 is 2 nM, and the concentration of staples is 10 nM.

Agarose Electrophoresis

Gel electrophoresis was conducted by a standard procedure as follows.

  1. Mix 1×TAE buffer 100 mL and agarose gel powder (Takara Japan) 1.0 g.
  2. Heat the mixture by microwave for about 30 seconds.
  3. Pour the heated mixture into the plastic case and leave it for about 46 minutes at 25 ℃.
  4. Set the gel on electrophoresis chamber (Mupid-2plus, Mupid, JAPAN).
  5. Mix 5 µL of sample and 1 µL of 6×Loding buffer.
  6. Apply 6 µL of each sample to wells.
  7. Apply 50 V for about 80 minutes.
  8. Stain the gel by SYBR GOLD for about 15 minutes.
  9. Observe fluorescence by gel imager (ChemiDoc MP, BIO-RAD, USA).

We confirmed the structure to observe our created DNA origami by AFM (Atomic force microscope).

Work flow of PEG purification

  1. 50 μL of PEG8000 solution (containing NaCl 505 mM and 1xTAE) same volume as target sample was added to 50 μL of sample (DNA origami) and mixed gently by hand. (Do not use a vortex machine)
  2. The mixed sample was centrifuged by 16000xG at 25℃ for 25 minutes.
  3. After centrifuging, 100 μL of whole solution was sucked from the centrifuged tube and 25 μL of buffer solution (containing 1xTAE and MgCl2 12.5 mM) was added into there.
  4. Measured concentration of the sample was around 2 nM.

We observed DNA origami purified by PEG purification by AFM. We used an observation buffer containing MgCl2 25 mM.

Observed sample →　DNA origami purified by PEG purification

* The observation buffer used for AFM observation is 1xTAE with MgCl2 25 mM.

(Usually the concentration of MgCl2 is 12.5 mM. We increased the concentration of MgCl2 for observing easily.)

Experiment B Confirmation of Strand Displacement Reaction

Experimental Condition

Table 3. Annealing Condition
Process Time
Annealing (65 ℃→25 ℃) 40 min
Incubation 45 min
Electrophoresis (Buffer：0.5×TBE) 60 min
Staining 15 min

DNA Sequence Design

Sample (B-1)

DNA１:GGAGCCGTGAACCATCATTATCAAACTG

DNA２:CAGTTTGATAATGATGGTTCACGGCTCC

DNA３:GGAGCCGTGAACCATCATTA

Sample (B-2)

DNA1: GCACCGCAGAGACCAGAGCAATTATCGC

DNA2: GCGATAATTGCTCTGGTCTCTGCGGTGCTTTTTTTTTTTTTTTTTTTTACTGGCGTGTGAGGTGAAGG

DNA3: GCACCGCAGAGACCAGAGCATTTTTTTTTTTTTTTTTTTTCCTTCACCTCACACGCCAGT

Acrylamide Electrophoresis

  1. Mix mQ 4.101 mL with 30% acrylamide (including BiS) 3 mL.
  2. Add 5xTBE 1.8 mL, TEMED 9 µL, 10% APS 90 µL, and swing the solution.
  3. Pour the mixture into the glass plates and leave it until the gel is solidified.
  4. Set the gel on electrophoresis chamber (Mupid-2plus, Mupid, JAPAN), and add 0.5xTBE buffer.
  5. Mix 5 µL of samples and 1 µL of 6×Loding buffer.
  6. Apply 6 µL of each sample to wells.
  7. Apply 50 V for about 60 minutes.
  8. Stain the gel by SYBR GOLD for about 15 minutes.
  9. Observe fluorescence by gel imager (ChemiDoc MP, BIO-RAD, USA).

Experiment C Confirmation of Restriction Enzyme Reaction

DNA sequences of experimence C-1

  • CGTAGAATTCCTGC
  • GCAGGAATTCTACG

DNA sequences of experimence C-2

  • TTTTTTTTTTTTTTTTTTTTGAATTCTTTTTTTTTTTTTTTTTTTTGCCAGCCGAGTGCGTGAGCC
  • TTTTTTTTTTTTTTTTTTTTGAATTCTTTTTTTTTTTTTTTTTTTTGGCTCACGCACTCGGCTGGC

Annealing Condition

65℃→25℃ (-1℃/m)

Incubation

37℃ (1h)→80℃ (30 min)→25℃ (hold)

Acrylamide Electrophoresis

  1. Mix mQ 4.101 mL with 30% acrylamide (including BiS) 3 mL.
  2. Add 5xTBE 1.8 mL, TEMED 9 µL, 10% APS 90 µL, and swing the solution.
  3. Pour the mixture into the glass plates and leave it until the gel is solidified.
  4. Set the gel on electrophoresis chamber (Mupid-2plus, Mupid, JAPAN), and add 1xTBE buffer.
  5. Mix 5 µL of samples and 1 µL of 6×Loding buffer.
  6. Apply 6 µL of each sample to wells.
  7. Apply 100 V for some minutes.
  8. Stain the gel by SYBR GOLD for about 15 minutes.
  9. Observe fluorescence by gel imager (ChemiDoc MP, BIO-RAD, USA).

Experiment D Confirmation of Restriction Enzyme Reaction

We observed DNA Origami Domino for 3 times. We prepared 3 kinds of DNA Origami Domino. The first one is equipped with a fluorescence on the first releaser strand. The second one is equipped with a fluorescence on second releaser strand. The third one is equipped with a fluorescence on third releaser strand. Also, we replaced the input strands with mQ as contrast.

Experiment Condition

Table. 4 Solution for the first and second experiment
Solution Concentration
DNA Origami 75 nM
MgCl2 12.5 mM
Input 100 nM
EcoR1 1.5 U/μL
1×TAE
Table. 5 Solution for the third experiment
Solution Concentration
DNA Origami 60 nM
MgCl2 12.5 mM
Input 500 nM
EcoR1 3.0 U/μL
1×TAE

Experiment Condition

We mixed this 3 kinds of DNA origami with MgCl2 and 1xTAE at the designed concentration. Then, we added the input strands and restriction enzymes and incubated the solutions at 37℃ for 15 min, 30 min, 60 min respectively.

Agarose Electrophoresis

  1. Mix mQ 4.101 mL with 30% acrylamide (including BiS) 3 mL.
  2. Add 5xTBE 1.8 mL, TEMED 9 µL, 10% APS 90 µL, and swing the solution.
  3. Pour the mixture into the glass plates and leave it until the gel is solidified.
  4. Set the gel on electrophoresis chamber (Mupid-2plus, Mupid, JAPAN), and add 0.5xTBE buffer.
  5. Mix 5 µL of samples and 1 µL of 6×Loding buffer.
  6. Apply 6 µL of each sample to wells.
  7. Apply 50 V for about 60 minutes.
  8. Stain the gel by SYBR GOLD for about 15 minutes.
  9. Observe fluorescence by gel imager (ChemiDoc MP, BIO-RAD, USA).

Team Sendai

Member

Shoji Iwabuchi, Yuki Takeda, Akihiko Fukuchi, Kouhei Mizuno, Toshihisa Suzuki, Yuki Watanabe, Hiroshi Kita,
Masahiro Miyazaki, Sho Aradachi, Kensei Kikuchi, Hu Jiamin

Mentor

Keitel Cervantes-Salguero, Yusuke Sato, Wataru Tobita, Ryo Kageyama, Koichiro Katayama, Takahiro Tomaru, Takuto hosoya, Hiroyuki Fujino, Théo Dammaretz, Thanapop Rodjanapanyakul, Yuto Otaki, Hayato Otaka, Taiki Watanabe, Satoru Akita, Keita Abe, Shosei Ichiseki, Takeo Uchida, Yuma Endo, Shiyun Liu

Supervisor

Ibuki Kawamata, Yuki Suzuki, Shin-ichiro M.Nomura, Satoshi Murata

Molecular Robotics LaboratoryGraduate School of Engineering,Tohoku University

Sponsors

References

  1. Qian, Lulu, and Erik Winfree. "Parallel and scalable computation and spatial dynamics with DNA-based chemical reaction networks on a surface." International Workshop on DNA-Based Computers. Springer International Publishing, 2014.
  2. Rothemund, Paul WK. "Folding DNA to create nanoscale shapes and patterns."Nature 440.7082 (2006): 297-302.
  3. Chenxiang Lin, Ralf Jungmann, Andrew M. Leifer, Chao Li, Daniel Levner, George M. Church, William M. Shih, Peng Yin. Submicrometre geometrically encoded fluorescent barcodes self-assembled from DNA. Nature Chemistry, 4, 832-839, 2012
  4. Yin, Peng, et al. "A unidirectional DNA walker that moves autonomously along a track." Angewandte Chemie International Edition 43.37 (2004): 4906-4911.
  5. Leonard M. Adleman. Molecular Computation of Solutions to Combinatorial Problems. Science, 266, 1021-1024, 1994
  6. Seelig, Georg, et al. "Enzyme-free nucleic acid logic circuits." Science 314.5805 (2006): 1585-1588.
  7. Sakamoto, Kensaku, et al. "State transitions by molecules." Biosystems 52.1 (1999): 81-91.
  8. Pardatscher, Günther, et al. "DNA condensation in one dimension." Nature Nanotechnology (2016).
  9. Boemo, Michael A., et al. "The Formal Language and Design Principles of Autonomous DNA Walker Circuits." ACS synthetic biology (2016).
  10. Suvir Venkataraman, Robert M. Dirks, Christine T. Ueda, Niles A. Pierce. Selective cell death mediated by small conditional RNAs. Proceedings of the National Academy of Sciences, 107, 16777-16782, 2010
  11. Satoshi Murata, Akihiko Konagaya, Satoshi Kobayashi, Hirohide Saito, Masami Hagiya. Molecular Robotics: A New Paradigm for Artifacts. New Generation Computing, 31, 27-45, 2013
  12. Shawn M. Douglas, Ido Bachelet, George M. Church. A Logic-Gated Nanorobot for Targeted Transport of Molecular Payloads. Science, 335, 831-834, 2012
  13. caDNAno:http://cadnano.org/

    M. Douglas, Adam H. Marblestone, Surat Teerapittayanon, Alejandro Vazquez, George M. Church, William M. Shih. Rapid prototyping of 3D DNA-origami shapes with caDNAno. Nucleic Acids Research, 37, 5001-5006 , 2009

  14. CanDo:http://cando-dna-origami.org/

    Carlos Ernesto Castro, Fabian Kilchherr, Do-Nyun Kim, Enrique Lin Shiao, Tobias Wauer, Philipp Wortmann, Mark Bathe, Hendrik Dietz. A primer to scaffolded DNA origami. Nature Methods, 8, 221-229, 2011

  15. Unity: http://unity3d.com/