SOURCES

DNA origami sequence

Below each 10mer DNA is complementary to DNA modified three fluorophores.

ATTO647N Fluoresceine Coumarin Tricolor

Sudare

Sudare1 
5'-GAAGGAAACCGAGGAATTTTAGATAGCCGAACAAAG-3'

Sudare2 
AGGTGGCAACATATAATTTTAACGTAGAAAATACAT

Sudare3 
ACCGTTCCAGTAAGCGTTTTGGAAAGCGCAGTCTCT

Sudare4 
GGGTTGATATAAGTATTTTTAGGCGGATAAGTGCCG

Sudare5 
TTTTCCATCGCCCACGCATATTTTGTTGCGCCGACAATGA

Sudare6 
GAGGCGCAGACGGTCATTTTCTCCATGTTACTTAGC

Sudare7 
TCAACTTTAATCATTGTTTTTTGGGCTTGAGATGGT

Sudare8 
AAAGACTTCAAATATCTTTTAAAAAGATTAAGAGGA

Sudare9 
AGAGGTCATTTTTGCGTTTTCCTTTAATTGCTCCTT

Sudare10 
GAATCGATGAACGGTATTTTTGAGAGTCTGGAGCAA

Sudare11 
AAGTAAGCTTTTACGCAATAATAACGGATTTTACGCAGTA

Sudare12 
TGTTAGCATTTTAAGAAACGCAAAGACATTTTTCATTAAA

Sudare13 
GCCAGAATTTTTTCATACATGGCTTTTGTTTTGGTTTTGC

Sudare14 
TCAGTACCTTTTAGCCCGGAATAGGTGTTTTTCAGCTTGA

Sudare15 
TACCGATATTTTACCGATATATTCGGTCTTTTCGAAATCC

Sudare16 
GCGACCTGTTTTATCATAAGGGAACCGATTTTCAGAACGA

Sudare17 
GTAGTAAATTTTTGAATTACCTTATGCGTTTTCAAAGCGG

Sudare18 
ATTGCATCTTTTGCGTTTTAATTCGAGCTTTTTCAGGATT

Sudare19 
AGAGAGTATTTTGATGGCTTAGAGCTTATTTTCTATCAGG

Sudare20 
TCATTGCCTTTTATCGTAAAACTAGCATGTCAATCA

Sudare21 
AATAGCTATCTTACCGAAGCCCTTTTTAAGAA

Sudare22 
AACAATAGATTAAGACTCCTTATTTTTTATACCCAA

Sudare23 
GGAGTGTATTTTACAAACAAATAAATCCTTTTCCACGGAA

Sudare24 
ACTCAGGATTTTGGATTAGGATTAGCGGTTTTATGATACA

Sudare25 
TTTTTTGCAGGGTTTTAGGTGAATTTCTTAAATTTTATCACCGT

Sudare26 
ACTTTGAATTTTGCCTGATAAATTGTGTTTTTGCTGAGGC

Sudare27 
AACTGGCTTTTTCCCTGACGAGAAACACTTTTACTGACCA

Sudare28 
TACCCTGACTATTATAGTCAGAAGTTTTATTTTAAG

Sudare29 
AATGAGTGAGCAAACTCCAACAGGTTTTTTCAAAGC

Sudare30 
TATGTACCTTTTGAGAGATCTACAAAGGTTTTATTGCTGA

Sudare31 
AAGAACTGTCCTGAACAAGAAAAATTTTTGTTTATC

Sudare32 
TAAGTTTATTTTGTCACAATCAATTTTTATTGGCCT

Sudare33 
TGATATTCTTTTCTGGTAATAAGTTTTATTTTAGACTCCT

Sudare34 
CAAGAGAATTTTGGTTTAGTACCGCCACTTTTTATCAGCT

Sudare35 
TGCTTTCGTTTTAGTTAAAGGCCGCTTTTTTTGGAGATTT

Sudare36 
GTATCATCTTTTAGAGGACAGATGAACGTTTTCAGTGAAT

Sudare37 
AAGGCTTGTTTTCATTATACCAGTCAGGTTTTCAGGTCTT

Sudare38 
GAACCAGAACTCACATTAATTGCGTTTTGGGTGCCT

Sudare39 
ATATAATGCTGTAGCTCAACATGTTTTTGAGGGTAG

Sudare40 
CTATTTTTTTTTCCGGTTGATAATCAGAAAAGCCCC

Sudare41 
CATCCTAATTTTAAGAGCAAGAAACAATGAAATAGC

Sudare42 
CATATGGTTTTTTAATGCAGAACGCGCCTTTTTAATATCC

Sudare43 
AGTGCCTTTTTTTGAGGCAGGTCAGACGTTTTAGAAAATT

Sudare44 
CCGCCACCTTTTAAGTATTAAGAGGCTGTTTTACGGGGTC

Sudare45 
TTTTCGTCACCCTTTTTTTAATTGTATCGGTTTTTTCCTCAGAA

Sudare46 
ACCAGGCGTTTTCGAAACAAAGTACAACTTTTTGCGGGAT

Sudare47 
AAGAAAAATTTTAACAAAGCTGCTCATTTTTTGTGTACAG

Sudare48 
ACTGCCCGTTTTACCATAAATCAAAAATTTTTACGTTGGG

Sudare49 
TGCAACTATTTTTAAAGTGTAAAGCCTGTTTTTTGCGCTC

Sudare50 
AAAAACAGTTTTATAAATTAATGCCGGATTTTTTTAAATA

Sudare51 
CCAATAATTTTTTTTACGAGCATGTAGATTTTAAACAACA

Sudare52 
TGTTCAGCTTTTTTACCAGCGCCAAAGATTTTAGCATTGA

Sudare53 
CAGGAGGTTTTTGAGTAACAGTGCCCGTTTTTTTATTCTG

Sudare54 
AAACATGATTTTCTCAGAACCGCCACCCTTTTGGCTCCAA

Sudare55 
AAGGAGCCTTTTTCAGCAGCGAAAGACATTTTGCGATTAT

Sudare56 
ACCAAGCGTTTTCATAGGCTGGCTGACCTTTTTTACCCAA

Sudare57 
ATCAACGTTTTTTCTACGTTAATAAAACTTTTTCAGAAAA

Sudare58 
CGAGAATGTTTTCTTTCCAGTCGGGAAATTTTATACGAGC

Sudare59 
CGGAAGCATTTTAAGTACGGTGTCTGGATTTTTCAACCGT

Sudare60 
TCTAGCTGTTTTGAAGATTGTATAAGCAAATATTTA

Sudare61 
AATAATCGTTTTTAACCCACAAGAATTGAGTTAAGC

Sudare62 
CGACATTCTTTTTCCAGACGACGACAATTTTTAACCAATC

Sudare63 
AGAACCACCACCAGAGCCGCCGCCTTTTCAAAAGGG

Sudare64 
AAACAAAACCTATTTCGGAACCTATTTTATAAACAG

Sudare65 
TTTTACGAGGGTTTTTAAATCTCCAAAAAAAATTTTTCAGAGCC

Sudare66 
TAAAACACTCATCTTTGACCCCCATTTTGCATCGGA

Sudare67 
GTAAAAGAAAGAACCGGATATTCATTTTTTCATCAA

Sudare68 
GCCAGCTGTTTTAAATGCTTTAAACAGTTTTTGAACTAAC

Sudare69 
TCCATATATTTTCACAATTCCACACAACTTTTCCTGTCGT

Sudare70 
AATTGTAATTTTACCATCAATATGATATTTTTAGTTTCAT

Sudare71 
CAGAGAGATTTTGCTGTCTTTCCTTATCTTTTAGGTAAAG

Sudare72 
TAATTCTGTTTTAACCGATTGAGGGAGGTTTTCCGCCACC

Sudare73 
TTAATGCCTACATTTAACAATTTCTTTTCATCAAGA

Sudare74 
ACCACCCTCATTTTCAGGGATAGCTTTTAATTTTTT

Sudare75 
CACGTTGATTTTAGCAACGGCTACAGAGTTTTGAATACAC

Sudare76 
GAGTAATCTCCATCACGCAAATTATTTTGCCACCGA

Sudare77 
GGAACAACATTATTACAGGTAGAATTTTTCATTGAA

Sudare78 
TCCCCCTCTTTTCATTAATGAATCGGCCTTTTGAAATTGT

Sudare79 
TATCCGCTTTTTACAGTTGATTCCCAATTTTTCGGAGACA

Sudare80 
GTCAAATCTTTTACGTTAATATTTTGTTAAAATTCG

Sudare81 
AACGGGTATTTTCAGAGGGTAATTGAGCGCTAATAT

Sudare82 
ATATTGACTTTTATAAAGTACCGACAAATTTTATTCCAAG

Sudare83 
TACCTTTTTTTTGCCACCACCCTCAGAGTTTTGAAGGTAA

Sudare84 
TAGGAACCTTTTAAGATGATGAAACAAATTTTATTTGAAT

Sudare85 
TTTTGACTAAAGTTTTAGGAATTGCGAATAATTTTTAAGCCCAA

Sudare86 
AGCAATACTTTTAACGAAAGAGGCAAAATTTTGCTTTGAG

Sudare87 
CAGTTGAGTTTTTTTTATAATCAGTGAGTTTTACCGTTGT

Sudare88 
GGGAGAGGTTTTGAATCGTCATAAATATTTTTAGATTCAT

Sudare89 
CGAGTAGATTTTTAGCTGTTTCCTGTGTTTTTAACGCGCG

Sudare90 
CATTAAATTTTTAAAGGGTGAGAAAGGCTTTTTCTGCGAA

Sudare91 
AACAAAGTTTTTTTAAACCAAGTACCGCTTTTCCAGTAAT

Sudare92 
AAGAGAATTTTTGGAAATTATTCATTAATTTTAACCGCCA

Sudare93 
CCCTCAGATTTTTTAATGGAAACAGTACTTTTATTACCTG

Sudare94 
AGCAAAAGTTTTCATGTACCGTAACACTTTTTAGAAAGGA

Sudare95 
ACAACTAATTTTACTTTTTCATGAGGAATTTTGAAGGCAC

Sudare96 
CAACCTAATTTTTTCTTTGATTAGTAATTTTTGAATCCTG

Sudare97 
AGAAGTGTTTTTATTTAGGAATACCACATTTTAGCGTCCA

Sudare98 
ATACTGCGTTTTCGGTTTGCGTATTGGGTTTTTTCGTAAT

Sudare99 
CATGGTCATTTTTTTAGTTTGACCATTATTTTTGTAGGTA

Sudare100 
AAGATTCATTTTTTTTGTTAAATCAGCTCATTTTTT

Sudare101 
AGAACAAGTTTTCGGGAGAATTAACTGAACACCCTG

Sudare102 
TATCACCGTTTTCAGAGGCATTTTCGAGTTTTACTCATCG

Sudare103 
ATATATGTTTTTGAGCCGCCACCCTCAGTTTTAGGTGAAT

Sudare104 
TCACCAGTTTTTCGAATTATTCATTTCATTTTATAAATCA

Sudare105 
CAACAGTTTCAGCGGAGTGAGAATTTTTGAGTTTCG

Sudare106 
ATTAACACTACGTAATGCCACTACTTTTGTTTCCAT

Sudare107 
ATGCAGATTTTTCAGGAACGGTACGCCATTTTAACATCAC

Sudare108 
TGGTTTTTTTTTAATGTTTAGACTGGATTTTTTTCAACTA

Sudare109 
TCGCAAATTTTTGGGTACCGAGCTCGAATTTTCGCCAGGG

Sudare110 
AACCAATATTTTCAATGCCTGAGTAATGTTTTGATACATT

Sudare111 
GCATTAGATTTTCAAGCCGTTTTTATTTTTTTCAACATGT

Sudare112 
AATTTAGGTTTTTCACCGACTTGAGCCATTTTGGAACCGC

Sudare113 
CTCCCTCATTTTGAGTGAATAACCTTGCTTTTCAAAATCG

Sudare114 
CGCAGAGGTTTTACAAACTACAACGCCTTTTTACAACTTT

Sudare115 
TTTTTAAACGGGGCAACAGTGCCACGCTTTTTCGGTCAGT

Sudare116 
TTGCCTGAGTAGAAGAACTCAAACTTTTTTAAAGGG

Sudare117 
ATTTTAGATTTTACATAACGCCAAAAGGTTTTGAGGGGGT

Sudare118 
AATAGTAATTTTCTTTTCACCAGTGAGATTTTACTCTAGA

Sudare119 
GGATCCCCTTTTGGTCAATAACCTGTTTTTTTTCATATAT

Sudare120 
TTTAAATGTTTTGGAACGCCATCAAAAATAATTCGC

Sudare121 
GGAATCATTTTTAGAATAACATAAAAACAGGGAAGC

Sudare122 
TTAGAGCCTTTTCCATATTTAACAACGCTTTTTCATCGTA

Sudare123 
ATCGTCGCTTTTAACCAGAGCCACCACCTTTTTTTGGGAA

Sudare124 
CCACAGACTTTTTTTGAATACCAAGTTATTTTTTCTGTAA

Sudare125 
TTTTGCAGCAAATTTTTATGGGATTTTGCTAATTTTGTAGCATT

Sudare126 
TTGCTGGTTTTTTAAAACAGAGGTGAGGTTTTGAGAGCCA

Sudare127 
GGCATAGTTTTTCTAAACAGGAGGCCGATTTTTATCGGCC

Sudare128 
AGCTGATTTTTTAAAAGAAGTTTTGCCATTTTAATTACGA

Sudare129 
TTTCATTTTTTTGCATGCCTGCAGGTCGTTTTCGGGCAAC

Sudare130 
GTCTGGCCTTTTAAAATTTTTAGAACCCTTTTAGCTATAT

Sudare131 
TTACAGAGTTTTTACCGCGCCCAATAGCTTTTGCTTAATT

Sudare132 
GAGAATCGTTTTAGCAAAATCACCAGTATTTTTAATCAAA

Sudare133 
ATCACCGGTTTTTATTAATTAATTTTCCTTTTGGATTCGC

Sudare134 
CTGATTGCTTTTAGCCCTCATAGTTAGCTTTTGTAAATGA

Sudare135 
TTTTATTTTCTGTTTTTGAAAAATCTAAAGCATTTTAACCACCA

Sudare136 
GCAGAAGATTTTAATATCCAGAACAATATTTTAGAATCAG

Sudare137 
AGCGGGAGTTTTAAGAGCAACACTATCATTTTAGCGAGAG

Sudare138 
GCTTTTGCTTTTGCCCTTCACCGCCTGGTTTTGGCCAGTG

Sudare139 
CCAAGCTTTTTTGGGGCGCGAGCTGAAATTTTTTTCAACG

Sudare140 
CAAGGATATTTTTTCCTGTAGCCAGCTTTCATCAAC

Sudare141 
CAGATATATTTTCGTCAAAAATGAAAATAGCAGCCT

Sudare142 
ACCATTAGTTTTAACGCTCAACAGTAGGTTTTAAGCAAAT

Sudare143 
CCTTGAAATTTTGTTTGCCATCTTTTCATTTTGCACCATT

Sudare144 
TTTTACATCGGGAGAAACAATAACTTTTCTTAGAAT

Sudare145 
TAACATTAGTCTTTCCAGACGTTATTTTGTAACGAT

Sudare146 
AGCCATTGTTTTTTAAAAATACCGAACGTTTTTCACCTTG

Sudare147 
CACGTATAACGTGCTTTCCTCGTTTTTTTTACCGCC

Sudare148 
ATCAAGTTCGATAAAAACCAAAATTTTTTAACCCTC

Sudare149 
TCAATTCTTTTTGACGTTGTAAAACGACTTTTCCCTGAGA

Sudare150 
ATTAAATGTTTTGCGGGAGAAGCCTTTATTTTAGGTGGCA

Sudare151 
TTGTTTAATTTTGAAGGCTTATCCGGTATTTTTTACCAGT

Sudare152 
ATAAAGCCTTTTCAAGGCCGGAAACGTCTTTTTAGCCCCC

Sudare153 
TTATTAGCTTTTACATAGCGATAGCTTATTTTACAGTACC

Sudare154 
CTAAAGTTTTGCGGAACAAAGAAATTTTAGTTTGAG

Sudare155 
CTGAACCTCAAATATCAAACCCTCTTTTCCCTAAAA

Sudare156 
CATCGCCATTTTCAACAGGAAAAACGCTTTTTTTGACGAG

Sudare157 
GTTTACCAGGGTCGAGGTGCCGTATTTTTCACCCAA

Sudare158 
GAGTTGCAGCAAGCGGTCCACGCTTTTTGGGTTTTC

Sudare159 
CCAGTCACTTTTACTAATAGTAGTAGCATTTTACCCTGTA

Sudare160 
ATACTTTTTTTTTGAGCGAGTAACAACCCGTCGGAT

Sudare161 
ACGCGAGGTTTTCCAATCCAAATAAGAAACGATTTT

Sudare162 
AACCATCGTTTTTGCGTTATACAAATTCTTTTTTCTAAGA

Sudare163 
CGCTGAGATTTTTCGGCATTTTCGGTCATTTTACCAATGA

Sudare164 
AGGAGCGGTTTTAGATGAATATACAGTATTTTGATTAAGA

Sudare165 
TTTTTCTGGTCATTTTCGTTATTAATTTTAAATTTTCCACCAGA

Sudare166 
TACCTACATTTTATGCGCGAACTGATAGTTTTAATCAATA

Sudare167 
AATCGGAATTTTGCGTACTATGGTTGCTTTTTCATGGAAA

Sudare168 
CCAGCAGGTTTTCCCACTACGTGAACCATTTTAAGCACTA

Sudare169 
CAATAAATTTTTAAGTTGGGTAACGCCATTTTGGTTTGCC

Sudare170 
TCTCCGTGTTTTTACCAAAAACATTATGTTTTTTAACATC

Sudare171 
TATTTATCTTTTCGTTTTAGCGAACCTCTTTTCCTGTTTA

Sudare172 
GTATCATATTTTATAGCAGCACCGTAATTTTTCTGTAGCG

Sudare173 
CGTTTTCATTTTAGAGTCAATAGTGAATTTTTTTTCAGGT

Sudare174 
TTAACGTCTTTTAATTATCATCATATTCTTTTAAATCCTT

Sudare175 
TGCCCGAATTTTGTTGGCAAATCAACAGTTTTTGGCTATT

Sudare176 
AGTCTTTATTTTTTTTGACGCTCAATCGTTTTTGCGCCGC

Sudare177 
TACAGGGCTTTTCCCTAAAGGGAGCCCCTTTTTCTATCAG

Sudare178 
GGCGATGGTTTTCGAAAATCCTGTTTGATTTTGTGCTGCA

Sudare179 
AGGCGATTTTTTCATACAGGCAAGGCAATTTTAAAGCTAA

Sudare180 
ATCGGTTGTTTTGGAACAAACGGCGGATTGACCGTA

Sudare181 
CGGGAGGTTTTTCAGTTACAAAATAAACAGCCATAT

Sudare182 
CGGAATCATAATTACTAGAAAAAGTTTTCCGACTTG

Sudare183 
AGAAAACTTGCCTTTAGCGTCAGATTTTCAGTAGCG

Sudare184 
CAGATGATTTTTAAGAAATTGCGTAGATTTTTTTATCAAA

Sudare185 
TTTTAATTGAGGTTTTTTCGACAACTCGTATTTTTTCTGATTAT

Sudare186 
GGATTATTTTTTAGACAATATTTTTGAATTTTTTGAAAGG

Sudare187 
AGCTTGACTTTTCACCCGCCGCGCTTAATTTTTCTGAAAT

Sudare188 
CCGAAATCTTTTAAAGGGCGAAAAACCGTTTTCGATTTAG

Sudare189 
TACGCCAGCTGGCGAAAGGGGGATTTTTTGGTGGTT

Sudare190 
CCAGCTTTTAAAGCCTCAGAGCATTTTTAGAATTAG

Sudare191 
TAATTTGCTTTTTTTGAAGCCTTAAATCTTTTATAAACAC

Sudare192 
ACAGAATCAAATATATTTTAGTTATTTTAGAACGCG

Sudare193 
ATCATAGGTCTGAGAGACTACCTTTTTTACGTAAAA

Sudare194 
CAGAAATATTTTGGCAATTCATCAATATTTTTTAGACTTT

Sudare195 
ACAAACAATTTTAAGGTTATCTAAAATATTTTTAAGAATA

Sudare196 
CGTGGCACTTTTTACATTGGCAGATTCATTTTCTGCGCGT

Sudare197 
AACCACCATTTTGGGGAAAGCCGGCGAATTTTCGTGGACT

Sudare198 
CCAACGTCTTTTGGCAAAATCCCTTATATTTTTTCGCTAT

Sudare199 
CAAAATTAACCGCTTCTGGTGCCGTTTTCACTCCAG

Sudare200 
ATGGGATAGGTCACGTTGGTGTAGATGGGCGC

Sudare201 
TTGCTATTTTTTGCTAACGAGCGTCTTTCCAGAGCC

Sudare202 
TTCTGACCTTTTAAGGCGTTAAATAAGATTTTAAGATTAG

Sudare203 
CCGGCTTATTTTTCCAATCGCAAGACAATTTTATTTCATC

Sudare204 
TTGTTTGGTTTTTATCAAAATTATTTGCTTTTTTTAACCT

Sudare205 
TTTTAGCACTAATTTTGAGGATTTAGAAGTATTTTTAATCCTGA

Sudare206 
ACGACCAGTTTTTTCTGACCTGAAAGCGTTTTTCTTTAGG

Sudare207 
GAAAGGAATTTTAAGTGTAGCGGTCACGTTTTCCAGTCAC

Sudare208 
GAATAGCCTTTTGTCCACTATTAAAGAATTTTCGTGGCGA

Sudare209 
GCAAAGCGTTTTGATCGGTGCGGGCCTCTTTTAATCAAAA

Sudare210 
ATCGTAACTTTTGGCCTCAGGAAGATCGTTTTGAAACCAG

Sudare211 
CCTGAATCTTACCAACTTTTTTGCACCCAGCTACAA

Sudare212 
CGACCGTGTGATAAATTTTTTAAATTTAATGGTTTG

Sudare213 
TAAATGCTGATGCAAATTTTGGTTGGGTTATATAAC

Sudare214 
GGGTTAGAACCTACCATTTTATTATACTTCTGAATA

Sudare215 
AATAGATAATACATTTTTTTCAACTAATAGATTAGA

Sudare216 
AACAGAGATAGAACCCTTTTTAATAAAAGGGACATT

Sudare217 
GCGCTAGGGCGCTGGCTTTTGGGAAGAAAGCGAAAG

Sudare218 
CCAGTTTGGAACAAGATTTTCGAGATAGGGTTGAGT

Sudare219 
AACTGTTGGGAAGGGCTTTTCCATTCGCCATTCAGG

Sudare220 
GGACGACGACAGTATCTTTTCGTGCATCTGCCAGTT


ATTO647N

Sudare1 
5'-CACGAAAGCCTTTTGAAGGAAACCGAGGAATTTTAGATAGCCGAACAAAG-3'

Sudare2 
AGGTGGCAACATATAATTTTAACGTAGAAAATACAT

Sudare3 
ACCGTTCCAGTAAGCGTTTTGGAAAGCGCAGTCTCT

Sudare4 
GGGTTGATATAAGTATTTTTAGGCGGATAAGTGCCG

Sudare5 
CCATCGCCCACGCATATTTTGTTGCGCCGACAATGA

Sudare6 
GAGGCGCAGACGGTCATTTTCTCCATGTTACTTAGC

Sudare7 
TCAACTTTAATCATTGTTTTTTGGGCTTGAGATGGT

Sudare8 
AAAGACTTCAAATATCTTTTAAAAAGATTAAGAGGA

Sudare9 
AGAGGTCATTTTTGCGTTTTCCTTTAATTGCTCCTT

Sudare10 
GAATCGATGAACGGTATTTTTGAGAGTCTGGAGCAA

Sudare11 
AAGTAAGCTTTTACGCAATAATAACGGATTTTACGCAGTA

Sudare12 
TGTTAGCATTTTAAGAAACGCAAAGACATTTTTCATTAAA

Sudare13 
GCCAGAATTTTTTCATACATGGCTTTTGTTTTGGTTTTGC

Sudare14 
TCAGTACCTTTTAGCCCGGAATAGGTGTTTTTCAGCTTGA

Sudare15 
TACCGATATTTTACCGATATATTCGGTCTTTTCGAAATCC

Sudare16 
GCGACCTGTTTTATCATAAGGGAACCGATTTTCAGAACGA

Sudare17 
GTAGTAAATTTTTGAATTACCTTATGCGTTTTCAAAGCGG

Sudare18 
ATTGCATCTTTTGCGTTTTAATTCGAGCTTTTTCAGGATT

Sudare19 
AGAGAGTATTTTGATGGCTTAGAGCTTATTTTCTATCAGG

Sudare20 
TCATTGCCTTTTATCGTAAAACTAGCATGTCAATCA

Sudare21 
CACGAAAGCCTTTTAATAGCTATCTTACCGAAGCCCTTTTTAAGAA

Sudare22 
AACAATAGATTAAGACTCCTTATTTTTTATACCCAA

Sudare23 
GGAGTGTATTTTACAAACAAATAAATCCTTTTCCACGGAA

Sudare24 
ACTCAGGATTTTGGATTAGGATTAGCGGTTTTATGATACA

Sudare25 
TTGCAGGGTTTTAGGTGAATTTCTTAAATTTTATCACCGT

Sudare26 
ACTTTGAATTTTGCCTGATAAATTGTGTTTTTGCTGAGGC

Sudare27 
AACTGGCTTTTTCCCTGACGAGAAACACTTTTACTGACCA

Sudare28 
TACCCTGACTATTATAGTCAGAAGTTTTATTTTAAG

Sudare29 
AATGAGTGAGCAAACTCCAACAGGTTTTTTCAAAGC

Sudare30 
TATGTACCTTTTGAGAGATCTACAAAGGTTTTATTGCTGA

Sudare31 
AAGAACTGTCCTGAACAAGAAAAATTTTTGTTTATC

Sudare32 
TAAGTTTATTTTGTCACAATCAATTTTTATTGGCCT

Sudare33 
TGATATTCTTTTCTGGTAATAAGTTTTATTTTAGACTCCT

Sudare34 
CAAGAGAATTTTGGTTTAGTACCGCCACTTTTTATCAGCT

Sudare35 
TGCTTTCGTTTTAGTTAAAGGCCGCTTTTTTTGGAGATTT

Sudare36 
GTATCATCTTTTAGAGGACAGATGAACGTTTTCAGTGAAT

Sudare37 
AAGGCTTGTTTTCATTATACCAGTCAGGTTTTCAGGTCTT

Sudare38 
GAACCAGAACTCACATTAATTGCGTTTTGGGTGCCT

Sudare39 
ATATAATGCTGTAGCTCAACATGTTTTTGAGGGTAG

Sudare40 
CTATTTTTTTTTCCGGTTGATAATCAGAAAAGCCCC

Sudare41 
CACGAAAGCCTTTTCATCCTAATTTTAAGAGCAAGAAACAATGAAATAGC

Sudare42 
CATATGGTTTTTTAATGCAGAACGCGCCTTTTTAATATCC

Sudare43 
AGTGCCTTTTTTTGAGGCAGGTCAGACGTTTTAGAAAATT

Sudare44 
CCGCCACCTTTTAAGTATTAAGAGGCTGTTTTACGGGGTC

Sudare45 
CGTCACCCTTTTTTTAATTGTATCGGTTTTTTCCTCAGAA

Sudare46 
ACCAGGCGTTTTCGAAACAAAGTACAACTTTTTGCGGGAT

Sudare47 
AAGAAAAATTTTAACAAAGCTGCTCATTTTTTGTGTACAG

Sudare48 
ACTGCCCGTTTTACCATAAATCAAAAATTTTTACGTTGGG

Sudare49 
TGCAACTATTTTTAAAGTGTAAAGCCTGTTTTTTGCGCTC

Sudare50 
AAAAACAGTTTTATAAATTAATGCCGGATTTTTTTAAATA

Sudare51 
CCAATAATTTTTTTTACGAGCATGTAGATTTTAAACAACA

Sudare52 
TGTTCAGCTTTTTTACCAGCGCCAAAGATTTTAGCATTGA

Sudare53 
CAGGAGGTTTTTGAGTAACAGTGCCCGTTTTTTTATTCTG

Sudare54 
AAACATGATTTTCTCAGAACCGCCACCCTTTTGGCTCCAA

Sudare55 
AAGGAGCCTTTTTCAGCAGCGAAAGACATTTTGCGATTAT

Sudare56 
ACCAAGCGTTTTCATAGGCTGGCTGACCTTTTTTACCCAA

Sudare57 
ATCAACGTTTTTTCTACGTTAATAAAACTTTTTCAGAAAA

Sudare58 
CGAGAATGTTTTCTTTCCAGTCGGGAAATTTTATACGAGC

Sudare59 
CGGAAGCATTTTAAGTACGGTGTCTGGATTTTTCAACCGT

Sudare60 
TCTAGCTGTTTTGAAGATTGTATAAGCAAATATTTA

Sudare61 
CACGAAAGCCTTTTAATAATCGTTTTTAACCCACAAGAATTGAGTTAAGC

Sudare62 
CGACATTCTTTTTCCAGACGACGACAATTTTTAACCAATC

Sudare63 
AGAACCACCACCAGAGCCGCCGCCTTTTCAAAAGGG

Sudare64 
AAACAAAACCTATTTCGGAACCTATTTTATAAACAG

Sudare65 
ACGAGGGTTTTTAAATCTCCAAAAAAAATTTTTCAGAGCC

Sudare66 
TAAAACACTCATCTTTGACCCCCATTTTGCATCGGA

Sudare67 
GTAAAAGAAAGAACCGGATATTCATTTTTTCATCAA

Sudare68 
GCCAGCTGTTTTAAATGCTTTAAACAGTTTTTGAACTAAC

Sudare69 
TCCATATATTTTCACAATTCCACACAACTTTTCCTGTCGT

Sudare70 
AATTGTAATTTTACCATCAATATGATATTTTTAGTTTCAT

Sudare71 
CAGAGAGATTTTGCTGTCTTTCCTTATCTTTTAGGTAAAG

Sudare72 
TAATTCTGTTTTAACCGATTGAGGGAGGTTTTCCGCCACC

Sudare73 
TTAATGCCTACATTTAACAATTTCTTTTCATCAAGA

Sudare74 
ACCACCCTCATTTTCAGGGATAGCTTTTAATTTTTT

Sudare75 
CACGTTGATTTTAGCAACGGCTACAGAGTTTTGAATACAC

Sudare76 
GAGTAATCTCCATCACGCAAATTATTTTGCCACCGA

Sudare77 
GGAACAACATTATTACAGGTAGAATTTTTCATTGAA

Sudare78 
TCCCCCTCTTTTCATTAATGAATCGGCCTTTTGAAATTGT

Sudare79 
TATCCGCTTTTTACAGTTGATTCCCAATTTTTCGGAGACA

Sudare80 
GTCAAATCTTTTACGTTAATATTTTGTTAAAATTCG

Sudare81 
CACGAAAGCCTTTTAACGGGTATTTTCAGAGGGTAATTGAGCGCTAATAT

Sudare82 
ATATTGACTTTTATAAAGTACCGACAAATTTTATTCCAAG

Sudare83 
TACCTTTTTTTTGCCACCACCCTCAGAGTTTTGAAGGTAA

Sudare84 
TAGGAACCTTTTAAGATGATGAAACAAATTTTATTTGAAT

Sudare85 
GACTAAAGTTTTAGGAATTGCGAATAATTTTTAAGCCCAA

Sudare86 
AGCAATACTTTTAACGAAAGAGGCAAAATTTTGCTTTGAG

Sudare87 
CAGTTGAGTTTTTTTTATAATCAGTGAGTTTTACCGTTGT

Sudare88 
GGGAGAGGTTTTGAATCGTCATAAATATTTTTAGATTCAT

Sudare89 
CGAGTAGATTTTTAGCTGTTTCCTGTGTTTTTAACGCGCG

Sudare90 
CATTAAATTTTTAAAGGGTGAGAAAGGCTTTTTCTGCGAA

Sudare91 
AACAAAGTTTTTTTAAACCAAGTACCGCTTTTCCAGTAAT

Sudare92 
AAGAGAATTTTTGGAAATTATTCATTAATTTTAACCGCCA

Sudare93 
CCCTCAGATTTTTTAATGGAAACAGTACTTTTATTACCTG

Sudare94 
AGCAAAAGTTTTCATGTACCGTAACACTTTTTAGAAAGGA

Sudare95 
ACAACTAATTTTACTTTTTCATGAGGAATTTTGAAGGCAC

Sudare96 
CAACCTAATTTTTTCTTTGATTAGTAATTTTTGAATCCTG

Sudare97 
AGAAGTGTTTTTATTTAGGAATACCACATTTTAGCGTCCA

Sudare98 
ATACTGCGTTTTCGGTTTGCGTATTGGGTTTTTTCGTAAT

Sudare99 
CATGGTCATTTTTTTAGTTTGACCATTATTTTTGTAGGTA

Sudare100 
AAGATTCATTTTTTTTGTTAAATCAGCTCATTTTTT

Sudare101 
CACGAAAGCCTTTTAGAACAAGTTTTCGGGAGAATTAACTGAACACCCTG

Sudare102 
TATCACCGTTTTCAGAGGCATTTTCGAGTTTTACTCATCG

Sudare103 
ATATATGTTTTTGAGCCGCCACCCTCAGTTTTAGGTGAAT

Sudare104 
TCACCAGTTTTTCGAATTATTCATTTCATTTTATAAATCA

Sudare105 
CAACAGTTTCAGCGGAGTGAGAATTTTTGAGTTTCG

Sudare106 
ATTAACACTACGTAATGCCACTACTTTTGTTTCCAT

Sudare107 
ATGCAGATTTTTCAGGAACGGTACGCCATTTTAACATCAC

Sudare108 
TGGTTTTTTTTTAATGTTTAGACTGGATTTTTTTCAACTA

Sudare109 
TCGCAAATTTTTGGGTACCGAGCTCGAATTTTCGCCAGGG

Sudare110 
AACCAATATTTTCAATGCCTGAGTAATGTTTTGATACATT

Sudare111 
GCATTAGATTTTCAAGCCGTTTTTATTTTTTTCAACATGT

Sudare112 
AATTTAGGTTTTTCACCGACTTGAGCCATTTTGGAACCGC

Sudare113 
CTCCCTCATTTTGAGTGAATAACCTTGCTTTTCAAAATCG

Sudare114 
CGCAGAGGTTTTACAAACTACAACGCCTTTTTACAACTTT

Sudare115 
TAAACGGGGCAACAGTGCCACGCTTTTTCGGTCAGT

Sudare116 
TTGCCTGAGTAGAAGAACTCAAACTTTTTTAAAGGG

Sudare117 
ATTTTAGATTTTACATAACGCCAAAAGGTTTTGAGGGGGT

Sudare118 
AATAGTAATTTTCTTTTCACCAGTGAGATTTTACTCTAGA

Sudare119 
GGATCCCCTTTTGGTCAATAACCTGTTTTTTTTCATATAT

Sudare120 
TTTAAATGTTTTGGAACGCCATCAAAAATAATTCGC

Sudare121 
CACGAAAGCCTTTTGGAATCATTTTTAGAATAACATAAAAACAGGGAAGC

Sudare122 
TTAGAGCCTTTTCCATATTTAACAACGCTTTTTCATCGTA

Sudare123 
ATCGTCGCTTTTAACCAGAGCCACCACCTTTTTTTGGGAA

Sudare124 
CCACAGACTTTTTTTGAATACCAAGTTATTTTTTCTGTAA

Sudare125 
GCAGCAAATTTTTATGGGATTTTGCTAATTTTGTAGCATT

Sudare126 
TTGCTGGTTTTTTAAAACAGAGGTGAGGTTTTGAGAGCCA

Sudare127 
GGCATAGTTTTTCTAAACAGGAGGCCGATTTTTATCGGCC

Sudare128 
AGCTGATTTTTTAAAAGAAGTTTTGCCATTTTAATTACGA

Sudare129 
TTTCATTTTTTTGCATGCCTGCAGGTCGTTTTCGGGCAAC

Sudare130 
GTCTGGCCTTTTAAAATTTTTAGAACCCTTTTAGCTATAT

Sudare131 
TTACAGAGTTTTTACCGCGCCCAATAGCTTTTGCTTAATT

Sudare132 
GAGAATCGTTTTAGCAAAATCACCAGTATTTTTAATCAAA

Sudare133 
ATCACCGGTTTTTATTAATTAATTTTCCTTTTGGATTCGC

Sudare134 
CTGATTGCTTTTAGCCCTCATAGTTAGCTTTTGTAAATGA

Sudare135 
ATTTTCTGTTTTTGAAAAATCTAAAGCATTTTAACCACCA

Sudare136 
GCAGAAGATTTTAATATCCAGAACAATATTTTAGAATCAG

Sudare137 
AGCGGGAGTTTTAAGAGCAACACTATCATTTTAGCGAGAG

Sudare138 
GCTTTTGCTTTTGCCCTTCACCGCCTGGTTTTGGCCAGTG

Sudare139 
CCAAGCTTTTTTGGGGCGCGAGCTGAAATTTTTTTCAACG

Sudare140 
CAAGGATATTTTTTCCTGTAGCCAGCTTTCATCAAC

Sudare141 
CACGAAAGCCTTTTCAGATATATTTTCGTCAAAAATGAAAATAGCAGCCT

Sudare142 
ACCATTAGTTTTAACGCTCAACAGTAGGTTTTAAGCAAAT

Sudare143 
CCTTGAAATTTTGTTTGCCATCTTTTCATTTTGCACCATT

Sudare144 
TTTTACATCGGGAGAAACAATAACTTTTCTTAGAAT

Sudare145 
TAACATTAGTCTTTCCAGACGTTATTTTGTAACGAT

Sudare146 
AGCCATTGTTTTTTAAAAATACCGAACGTTTTTCACCTTG

Sudare147 
CACGTATAACGTGCTTTCCTCGTTTTTTTTACCGCC

Sudare148 
ATCAAGTTCGATAAAAACCAAAATTTTTTAACCCTC

Sudare149 
TCAATTCTTTTTGACGTTGTAAAACGACTTTTCCCTGAGA

Sudare150 
ATTAAATGTTTTGCGGGAGAAGCCTTTATTTTAGGTGGCA

Sudare151 
TTGTTTAATTTTGAAGGCTTATCCGGTATTTTTTACCAGT

Sudare152 
ATAAAGCCTTTTCAAGGCCGGAAACGTCTTTTTAGCCCCC

Sudare153 
TTATTAGCTTTTACATAGCGATAGCTTATTTTACAGTACC

Sudare154 
CTAAAGTTTTGCGGAACAAAGAAATTTTAGTTTGAG

Sudare155 
CTGAACCTCAAATATCAAACCCTCTTTTCCCTAAAA

Sudare156 
CATCGCCATTTTCAACAGGAAAAACGCTTTTTTTGACGAG

Sudare157 
GTTTACCAGGGTCGAGGTGCCGTATTTTTCACCCAA

Sudare158 
GAGTTGCAGCAAGCGGTCCACGCTTTTTGGGTTTTC

Sudare159 
CCAGTCACTTTTACTAATAGTAGTAGCATTTTACCCTGTA

Sudare160 
ATACTTTTTTTTTGAGCGAGTAACAACCCGTCGGAT

Sudare161 
CACGAAAGCCTTTTACGCGAGGTTTTCCAATCCAAATAAGAAACGATTTT

Sudare162 
AACCATCGTTTTTGCGTTATACAAATTCTTTTTTCTAAGA

Sudare163 
CGCTGAGATTTTTCGGCATTTTCGGTCATTTTACCAATGA

Sudare164 
AGGAGCGGTTTTAGATGAATATACAGTATTTTGATTAAGA

Sudare165 
TCTGGTCATTTTCGTTATTAATTTTAAATTTTCCACCAGA

Sudare166 
TACCTACATTTTATGCGCGAACTGATAGTTTTAATCAATA

Sudare167 
AATCGGAATTTTGCGTACTATGGTTGCTTTTTCATGGAAA

Sudare168 
CCAGCAGGTTTTCCCACTACGTGAACCATTTTAAGCACTA

Sudare169 
CAATAAATTTTTAAGTTGGGTAACGCCATTTTGGTTTGCC

Sudare170 
TCTCCGTGTTTTTACCAAAAACATTATGTTTTTTAACATC

Sudare171 
TATTTATCTTTTCGTTTTAGCGAACCTCTTTTCCTGTTTA

Sudare172 
GTATCATATTTTATAGCAGCACCGTAATTTTTCTGTAGCG

Sudare173 
CGTTTTCATTTTAGAGTCAATAGTGAATTTTTTTTCAGGT

Sudare174 
TTAACGTCTTTTAATTATCATCATATTCTTTTAAATCCTT

Sudare175 
TGCCCGAATTTTGTTGGCAAATCAACAGTTTTTGGCTATT

Sudare176 
AGTCTTTATTTTTTTTGACGCTCAATCGTTTTTGCGCCGC

Sudare177 
TACAGGGCTTTTCCCTAAAGGGAGCCCCTTTTTCTATCAG

Sudare178 
GGCGATGGTTTTCGAAAATCCTGTTTGATTTTGTGCTGCA

Sudare179 
AGGCGATTTTTTCATACAGGCAAGGCAATTTTAAAGCTAA

Sudare180 
ATCGGTTGTTTTGGAACAAACGGCGGATTGACCGTA

Sudare181 
CACGAAAGCCTTTTCGGGAGGTTTTTCAGTTACAAAATAAACAGCCATAT

Sudare182 
CGGAATCATAATTACTAGAAAAAGTTTTCCGACTTG

Sudare183 
AGAAAACTTGCCTTTAGCGTCAGATTTTCAGTAGCG

Sudare184 
CAGATGATTTTTAAGAAATTGCGTAGATTTTTTTATCAAA

Sudare185 
AATTGAGGTTTTTTCGACAACTCGTATTTTTTCTGATTAT

Sudare186 
GGATTATTTTTTAGACAATATTTTTGAATTTTTTGAAAGG

Sudare187 
AGCTTGACTTTTCACCCGCCGCGCTTAATTTTTCTGAAAT

Sudare188 
CCGAAATCTTTTAAAGGGCGAAAAACCGTTTTCGATTTAG

Sudare189 
TACGCCAGCTGGCGAAAGGGGGATTTTTTGGTGGTT

Sudare190 
CCAGCTTTTAAAGCCTCAGAGCATTTTTAGAATTAG

Sudare191 
TAATTTGCTTTTTTTGAAGCCTTAAATCTTTTATAAACAC

Sudare192 
ACAGAATCAAATATATTTTAGTTATTTTAGAACGCG

Sudare193 
ATCATAGGTCTGAGAGACTACCTTTTTTACGTAAAA

Sudare194 
CAGAAATATTTTGGCAATTCATCAATATTTTTTAGACTTT

Sudare195 
ACAAACAATTTTAAGGTTATCTAAAATATTTTTAAGAATA

Sudare196 
CGTGGCACTTTTTACATTGGCAGATTCATTTTCTGCGCGT

Sudare197 
AACCACCATTTTGGGGAAAGCCGGCGAATTTTCGTGGACT

Sudare198 
CCAACGTCTTTTGGCAAAATCCCTTATATTTTTTCGCTAT

Sudare199 
CAAAATTAACCGCTTCTGGTGCCGTTTTCACTCCAG

Sudare200 
ATGGGATAGGTCACGTTGGTGTAGATGGGCGC

Sudare201 
CACGAAAGCCTTTTTTGCTATTTTTTGCTAACGAGCGTCTTTCCAGAGCC

Sudare202 
TTCTGACCTTTTAAGGCGTTAAATAAGATTTTAAGATTAG

Sudare203 
CCGGCTTATTTTTCCAATCGCAAGACAATTTTATTTCATC

Sudare204 
TTGTTTGGTTTTTATCAAAATTATTTGCTTTTTTTAACCT

Sudare205 
AGCACTAATTTTGAGGATTTAGAAGTATTTTTAATCCTGA

Sudare206 
ACGACCAGTTTTTTCTGACCTGAAAGCGTTTTTCTTTAGG

Sudare207 
GAAAGGAATTTTAAGTGTAGCGGTCACGTTTTCCAGTCAC

Sudare208 
GAATAGCCTTTTGTCCACTATTAAAGAATTTTCGTGGCGA

Sudare209 
GCAAAGCGTTTTGATCGGTGCGGGCCTCTTTTAATCAAAA

Sudare210 
ATCGTAACTTTTGGCCTCAGGAAGATCGTTTTGAAACCAG

Sudare211 
CCTGAATCTTACCAACTTTTTTGCACCCAGCTACAA

Sudare212 
CGACCGTGTGATAAATTTTTTAAATTTAATGGTTTG

Sudare213 
TAAATGCTGATGCAAATTTTGGTTGGGTTATATAAC

Sudare214 
GGGTTAGAACCTACCATTTTATTATACTTCTGAATA

Sudare215 
AATAGATAATACATTTTTTTCAACTAATAGATTAGA

Sudare216 
AACAGAGATAGAACCCTTTTTAATAAAAGGGACATT

Sudare217 
GCGCTAGGGCGCTGGCTTTTGGGAAGAAAGCGAAAG

Sudare218 
CCAGTTTGGAACAAGATTTTCGAGATAGGGTTGAGT

Sudare219 
AACTGTTGGGAAGGGCTTTTCCATTCGCCATTCAGG

Sudare220 
GGACGACGACAGTATCTTTTCGTGCATCTGCCAGTT


Fluoresceine

Sudare1 
5'-GAAGGAAACCGAGGAATTTTAGATAGCCGAACAAAG-3'

Sudare2 
AGGTGGCAACATATAATTTTAACGTAGAAAATACAT

Sudare3 
ACCGTTCCAGTAAGCGTTTTGGAAAGCGCAGTCTCT

Sudare4 
GGGTTGATATAAGTATTTTTAGGCGGATAAGTGCCG

Sudare5 
CTACCTGCACTTTTCCATCGCCCACGCATATTTTGTTGCGCCGACAATGA

Sudare6 
GAGGCGCAGACGGTCATTTTCTCCATGTTACTTAGC

Sudare7 
TCAACTTTAATCATTGTTTTTTGGGCTTGAGATGGT

Sudare8 
AAAGACTTCAAATATCTTTTAAAAAGATTAAGAGGA

Sudare9 
AGAGGTCATTTTTGCGTTTTCCTTTAATTGCTCCTT

Sudare10 
GAATCGATGAACGGTATTTTTGAGAGTCTGGAGCAA

Sudare11 
AAGTAAGCTTTTACGCAATAATAACGGATTTTACGCAGTA

Sudare12 
TGTTAGCATTTTAAGAAACGCAAAGACATTTTTCATTAAA

Sudare13 
GCCAGAATTTTTTCATACATGGCTTTTGTTTTGGTTTTGC

Sudare14 
TCAGTACCTTTTAGCCCGGAATAGGTGTTTTTCAGCTTGA

Sudare15 
TACCGATATTTTACCGATATATTCGGTCTTTTCGAAATCC

Sudare16 
GCGACCTGTTTTATCATAAGGGAACCGATTTTCAGAACGA

Sudare17 
GTAGTAAATTTTTGAATTACCTTATGCGTTTTCAAAGCGG

Sudare18 
ATTGCATCTTTTGCGTTTTAATTCGAGCTTTTTCAGGATT

Sudare19 
AGAGAGTATTTTGATGGCTTAGAGCTTATTTTCTATCAGG

Sudare20 
TCATTGCCTTTTATCGTAAAACTAGCATGTCAATCA

Sudare21 
AATAGCTATCTTACCGAAGCCCTTTTTAAGAA

Sudare22 
AACAATAGATTAAGACTCCTTATTTTTTATACCCAA

Sudare23 
GGAGTGTATTTTACAAACAAATAAATCCTTTTCCACGGAA

Sudare24 
ACTCAGGATTTTGGATTAGGATTAGCGGTTTTATGATACA

Sudare25 
CTACCTGCACTTTTTTGCAGGGTTTTAGGTGAATTTCTTAAATTTTATCACCGT

Sudare26 
ACTTTGAATTTTGCCTGATAAATTGTGTTTTTGCTGAGGC

Sudare27 
AACTGGCTTTTTCCCTGACGAGAAACACTTTTACTGACCA

Sudare28 
TACCCTGACTATTATAGTCAGAAGTTTTATTTTAAG

Sudare29 
AATGAGTGAGCAAACTCCAACAGGTTTTTTCAAAGC

Sudare30 
TATGTACCTTTTGAGAGATCTACAAAGGTTTTATTGCTGA

Sudare31 
AAGAACTGTCCTGAACAAGAAAAATTTTTGTTTATC

Sudare32 
TAAGTTTATTTTGTCACAATCAATTTTTATTGGCCT

Sudare33 
TGATATTCTTTTCTGGTAATAAGTTTTATTTTAGACTCCT

Sudare34 
CAAGAGAATTTTGGTTTAGTACCGCCACTTTTTATCAGCT

Sudare35 
TGCTTTCGTTTTAGTTAAAGGCCGCTTTTTTTGGAGATTT

Sudare36 
GTATCATCTTTTAGAGGACAGATGAACGTTTTCAGTGAAT

Sudare37 
AAGGCTTGTTTTCATTATACCAGTCAGGTTTTCAGGTCTT

Sudare38 
GAACCAGAACTCACATTAATTGCGTTTTGGGTGCCT

Sudare39 
ATATAATGCTGTAGCTCAACATGTTTTTGAGGGTAG

Sudare40 
CTATTTTTTTTTCCGGTTGATAATCAGAAAAGCCCC

Sudare41 
CATCCTAATTTTAAGAGCAAGAAACAATGAAATAGC

Sudare42 
CATATGGTTTTTTAATGCAGAACGCGCCTTTTTAATATCC

Sudare43 
AGTGCCTTTTTTTGAGGCAGGTCAGACGTTTTAGAAAATT

Sudare44 
CCGCCACCTTTTAAGTATTAAGAGGCTGTTTTACGGGGTC

Sudare45 
CTACCTGCACTTTTCGTCACCCTTTTTTTAATTGTATCGGTTTTTTCCTCAGAA

Sudare46 
ACCAGGCGTTTTCGAAACAAAGTACAACTTTTTGCGGGAT

Sudare47 
AAGAAAAATTTTAACAAAGCTGCTCATTTTTTGTGTACAG

Sudare48 
ACTGCCCGTTTTACCATAAATCAAAAATTTTTACGTTGGG

Sudare49 
TGCAACTATTTTTAAAGTGTAAAGCCTGTTTTTTGCGCTC

Sudare50 
AAAAACAGTTTTATAAATTAATGCCGGATTTTTTTAAATA

Sudare51 
CCAATAATTTTTTTTACGAGCATGTAGATTTTAAACAACA

Sudare52 
TGTTCAGCTTTTTTACCAGCGCCAAAGATTTTAGCATTGA

Sudare53 
CAGGAGGTTTTTGAGTAACAGTGCCCGTTTTTTTATTCTG

Sudare54 
AAACATGATTTTCTCAGAACCGCCACCCTTTTGGCTCCAA

Sudare55 
AAGGAGCCTTTTTCAGCAGCGAAAGACATTTTGCGATTAT

Sudare56 
ACCAAGCGTTTTCATAGGCTGGCTGACCTTTTTTACCCAA

Sudare57 
ATCAACGTTTTTTCTACGTTAATAAAACTTTTTCAGAAAA

Sudare58 
CGAGAATGTTTTCTTTCCAGTCGGGAAATTTTATACGAGC

Sudare59 
CGGAAGCATTTTAAGTACGGTGTCTGGATTTTTCAACCGT

Sudare60 
TCTAGCTGTTTTGAAGATTGTATAAGCAAATATTTA

Sudare61 
AATAATCGTTTTTAACCCACAAGAATTGAGTTAAGC

Sudare62 
CGACATTCTTTTTCCAGACGACGACAATTTTTAACCAATC

Sudare63 
AGAACCACCACCAGAGCCGCCGCCTTTTCAAAAGGG

Sudare64 
AAACAAAACCTATTTCGGAACCTATTTTATAAACAG

Sudare65 
CTACCTGCACTTTTACGAGGGTTTTTAAATCTCCAAAAAAAATTTTTCAGAGCC

Sudare66 
TAAAACACTCATCTTTGACCCCCATTTTGCATCGGA

Sudare67 
GTAAAAGAAAGAACCGGATATTCATTTTTTCATCAA

Sudare68 
GCCAGCTGTTTTAAATGCTTTAAACAGTTTTTGAACTAAC

Sudare69 
TCCATATATTTTCACAATTCCACACAACTTTTCCTGTCGT

Sudare70 
AATTGTAATTTTACCATCAATATGATATTTTTAGTTTCAT

Sudare71 
CAGAGAGATTTTGCTGTCTTTCCTTATCTTTTAGGTAAAG

Sudare72 
TAATTCTGTTTTAACCGATTGAGGGAGGTTTTCCGCCACC

Sudare73 
TTAATGCCTACATTTAACAATTTCTTTTCATCAAGA

Sudare74 
ACCACCCTCATTTTCAGGGATAGCTTTTAATTTTTT

Sudare75 
CACGTTGATTTTAGCAACGGCTACAGAGTTTTGAATACAC

Sudare76 
GAGTAATCTCCATCACGCAAATTATTTTGCCACCGA

Sudare77 
GGAACAACATTATTACAGGTAGAATTTTTCATTGAA

Sudare78 
TCCCCCTCTTTTCATTAATGAATCGGCCTTTTGAAATTGT

Sudare79 
TATCCGCTTTTTACAGTTGATTCCCAATTTTTCGGAGACA

Sudare80 
GTCAAATCTTTTACGTTAATATTTTGTTAAAATTCG

Sudare81 
AACGGGTATTTTCAGAGGGTAATTGAGCGCTAATAT

Sudare82 
ATATTGACTTTTATAAAGTACCGACAAATTTTATTCCAAG

Sudare83 
TACCTTTTTTTTGCCACCACCCTCAGAGTTTTGAAGGTAA

Sudare84 
TAGGAACCTTTTAAGATGATGAAACAAATTTTATTTGAAT

Sudare85 
CTACCTGCACTTTTGACTAAAGTTTTAGGAATTGCGAATAATTTTTAAGCCCAA

Sudare86 
AGCAATACTTTTAACGAAAGAGGCAAAATTTTGCTTTGAG

Sudare87 
CAGTTGAGTTTTTTTTATAATCAGTGAGTTTTACCGTTGT

Sudare88 
GGGAGAGGTTTTGAATCGTCATAAATATTTTTAGATTCAT

Sudare89 
CGAGTAGATTTTTAGCTGTTTCCTGTGTTTTTAACGCGCG

Sudare90 
CATTAAATTTTTAAAGGGTGAGAAAGGCTTTTTCTGCGAA

Sudare91 
AACAAAGTTTTTTTAAACCAAGTACCGCTTTTCCAGTAAT

Sudare92 
AAGAGAATTTTTGGAAATTATTCATTAATTTTAACCGCCA

Sudare93 
CCCTCAGATTTTTTAATGGAAACAGTACTTTTATTACCTG

Sudare94 
AGCAAAAGTTTTCATGTACCGTAACACTTTTTAGAAAGGA

Sudare95 
ACAACTAATTTTACTTTTTCATGAGGAATTTTGAAGGCAC

Sudare96 
CAACCTAATTTTTTCTTTGATTAGTAATTTTTGAATCCTG

Sudare97 
AGAAGTGTTTTTATTTAGGAATACCACATTTTAGCGTCCA

Sudare98 
ATACTGCGTTTTCGGTTTGCGTATTGGGTTTTTTCGTAAT

Sudare99 
CATGGTCATTTTTTTAGTTTGACCATTATTTTTGTAGGTA

Sudare100 
AAGATTCATTTTTTTTGTTAAATCAGCTCATTTTTT

Sudare101 
AGAACAAGTTTTCGGGAGAATTAACTGAACACCCTG

Sudare102 
TATCACCGTTTTCAGAGGCATTTTCGAGTTTTACTCATCG

Sudare103 
ATATATGTTTTTGAGCCGCCACCCTCAGTTTTAGGTGAAT

Sudare104 
TCACCAGTTTTTCGAATTATTCATTTCATTTTATAAATCA

Sudare105 
CAACAGTTTCAGCGGAGTGAGAATTTTTGAGTTTCG

Sudare106 
ATTAACACTACGTAATGCCACTACTTTTGTTTCCAT

Sudare107 
ATGCAGATTTTTCAGGAACGGTACGCCATTTTAACATCAC

Sudare108 
TGGTTTTTTTTTAATGTTTAGACTGGATTTTTTTCAACTA

Sudare109 
TCGCAAATTTTTGGGTACCGAGCTCGAATTTTCGCCAGGG

Sudare110 
AACCAATATTTTCAATGCCTGAGTAATGTTTTGATACATT

Sudare111 
GCATTAGATTTTCAAGCCGTTTTTATTTTTTTCAACATGT

Sudare112 
AATTTAGGTTTTTCACCGACTTGAGCCATTTTGGAACCGC

Sudare113 
CTCCCTCATTTTGAGTGAATAACCTTGCTTTTCAAAATCG

Sudare114 
CGCAGAGGTTTTACAAACTACAACGCCTTTTTACAACTTT

Sudare115 
CTACCTGCACTTTTTAAACGGGGCAACAGTGCCACGCTTTTTCGGTCAGT

Sudare116 
TTGCCTGAGTAGAAGAACTCAAACTTTTTTAAAGGG

Sudare117 
ATTTTAGATTTTACATAACGCCAAAAGGTTTTGAGGGGGT

Sudare118 
AATAGTAATTTTCTTTTCACCAGTGAGATTTTACTCTAGA

Sudare119 
GGATCCCCTTTTGGTCAATAACCTGTTTTTTTTCATATAT

Sudare120 
TTTAAATGTTTTGGAACGCCATCAAAAATAATTCGC

Sudare121 
GGAATCATTTTTAGAATAACATAAAAACAGGGAAGC

Sudare122 
TTAGAGCCTTTTCCATATTTAACAACGCTTTTTCATCGTA

Sudare123 
ATCGTCGCTTTTAACCAGAGCCACCACCTTTTTTTGGGAA

Sudare124 
CCACAGACTTTTTTTGAATACCAAGTTATTTTTTCTGTAA

Sudare125 
CTACCTGCACTTTTGCAGCAAATTTTTATGGGATTTTGCTAATTTTGTAGCATT

Sudare126 
TTGCTGGTTTTTTAAAACAGAGGTGAGGTTTTGAGAGCCA

Sudare127 
GGCATAGTTTTTCTAAACAGGAGGCCGATTTTTATCGGCC

Sudare128 
AGCTGATTTTTTAAAAGAAGTTTTGCCATTTTAATTACGA

Sudare129 
TTTCATTTTTTTGCATGCCTGCAGGTCGTTTTCGGGCAAC

Sudare130 
GTCTGGCCTTTTAAAATTTTTAGAACCCTTTTAGCTATAT

Sudare131 
TTACAGAGTTTTTACCGCGCCCAATAGCTTTTGCTTAATT

Sudare132 
GAGAATCGTTTTAGCAAAATCACCAGTATTTTTAATCAAA

Sudare133 
ATCACCGGTTTTTATTAATTAATTTTCCTTTTGGATTCGC

Sudare134 
CTGATTGCTTTTAGCCCTCATAGTTAGCTTTTGTAAATGA

Sudare135 
CTACCTGCACTTTTATTTTCTGTTTTTGAAAAATCTAAAGCATTTTAACCACCA

Sudare136 
GCAGAAGATTTTAATATCCAGAACAATATTTTAGAATCAG

Sudare137 
AGCGGGAGTTTTAAGAGCAACACTATCATTTTAGCGAGAG

Sudare138 
GCTTTTGCTTTTGCCCTTCACCGCCTGGTTTTGGCCAGTG

Sudare139 
CCAAGCTTTTTTGGGGCGCGAGCTGAAATTTTTTTCAACG

Sudare140 
CAAGGATATTTTTTCCTGTAGCCAGCTTTCATCAAC

Sudare141 
CAGATATATTTTCGTCAAAAATGAAAATAGCAGCCT

Sudare142 
ACCATTAGTTTTAACGCTCAACAGTAGGTTTTAAGCAAAT

Sudare143 
CCTTGAAATTTTGTTTGCCATCTTTTCATTTTGCACCATT

Sudare144 
TTTTACATCGGGAGAAACAATAACTTTTCTTAGAAT

Sudare145 
TAACATTAGTCTTTCCAGACGTTATTTTGTAACGAT

Sudare146 
AGCCATTGTTTTTTAAAAATACCGAACGTTTTTCACCTTG

Sudare147 
CACGTATAACGTGCTTTCCTCGTTTTTTTTACCGCC

Sudare148 
ATCAAGTTCGATAAAAACCAAAATTTTTTAACCCTC

Sudare149 
TCAATTCTTTTTGACGTTGTAAAACGACTTTTCCCTGAGA

Sudare150 
ATTAAATGTTTTGCGGGAGAAGCCTTTATTTTAGGTGGCA

Sudare151 
TTGTTTAATTTTGAAGGCTTATCCGGTATTTTTTACCAGT

Sudare152 
ATAAAGCCTTTTCAAGGCCGGAAACGTCTTTTTAGCCCCC

Sudare153 
TTATTAGCTTTTACATAGCGATAGCTTATTTTACAGTACC

Sudare154 
CTAAAGTTTTGCGGAACAAAGAAATTTTAGTTTGAG

Sudare155 
CTGAACCTCAAATATCAAACCCTCTTTTCCCTAAAA

Sudare156 
CATCGCCATTTTCAACAGGAAAAACGCTTTTTTTGACGAG

Sudare157 
GTTTACCAGGGTCGAGGTGCCGTATTTTTCACCCAA

Sudare158 
GAGTTGCAGCAAGCGGTCCACGCTTTTTGGGTTTTC

Sudare159 
CCAGTCACTTTTACTAATAGTAGTAGCATTTTACCCTGTA

Sudare160 
ATACTTTTTTTTTGAGCGAGTAACAACCCGTCGGAT

Sudare161 
ACGCGAGGTTTTCCAATCCAAATAAGAAACGATTTT

Sudare162 
AACCATCGTTTTTGCGTTATACAAATTCTTTTTTCTAAGA

Sudare163 
CGCTGAGATTTTTCGGCATTTTCGGTCATTTTACCAATGA

Sudare164 
AGGAGCGGTTTTAGATGAATATACAGTATTTTGATTAAGA

Sudare165 
CTACCTGCACTTTTTCTGGTCATTTTCGTTATTAATTTTAAATTTTCCACCAGA

Sudare166 
TACCTACATTTTATGCGCGAACTGATAGTTTTAATCAATA

Sudare167 
AATCGGAATTTTGCGTACTATGGTTGCTTTTTCATGGAAA

Sudare168 
CCAGCAGGTTTTCCCACTACGTGAACCATTTTAAGCACTA

Sudare169 
CAATAAATTTTTAAGTTGGGTAACGCCATTTTGGTTTGCC

Sudare170 
TCTCCGTGTTTTTACCAAAAACATTATGTTTTTTAACATC

Sudare171 
TATTTATCTTTTCGTTTTAGCGAACCTCTTTTCCTGTTTA

Sudare172 
GTATCATATTTTATAGCAGCACCGTAATTTTTCTGTAGCG

Sudare173 
CGTTTTCATTTTAGAGTCAATAGTGAATTTTTTTTCAGGT

Sudare174 
TTAACGTCTTTTAATTATCATCATATTCTTTTAAATCCTT

Sudare175 
TGCCCGAATTTTGTTGGCAAATCAACAGTTTTTGGCTATT

Sudare176 
AGTCTTTATTTTTTTTGACGCTCAATCGTTTTTGCGCCGC

Sudare177 
TACAGGGCTTTTCCCTAAAGGGAGCCCCTTTTTCTATCAG

Sudare178 
GGCGATGGTTTTCGAAAATCCTGTTTGATTTTGTGCTGCA

Sudare179 
AGGCGATTTTTTCATACAGGCAAGGCAATTTTAAAGCTAA

Sudare180 
ATCGGTTGTTTTGGAACAAACGGCGGATTGACCGTA

Sudare181 
CGGGAGGTTTTTCAGTTACAAAATAAACAGCCATAT

Sudare182 
CGGAATCATAATTACTAGAAAAAGTTTTCCGACTTG

Sudare183 
AGAAAACTTGCCTTTAGCGTCAGATTTTCAGTAGCG

Sudare184 
CAGATGATTTTTAAGAAATTGCGTAGATTTTTTTATCAAA

Sudare185 
CTACCTGCACTTTTAATTGAGGTTTTTTCGACAACTCGTATTTTTTCTGATTAT

Sudare186 
GGATTATTTTTTAGACAATATTTTTGAATTTTTTGAAAGG

Sudare187 
AGCTTGACTTTTCACCCGCCGCGCTTAATTTTTCTGAAAT

Sudare188 
CCGAAATCTTTTAAAGGGCGAAAAACCGTTTTCGATTTAG

Sudare189 
TACGCCAGCTGGCGAAAGGGGGATTTTTTGGTGGTT

Sudare190 
CCAGCTTTTAAAGCCTCAGAGCATTTTTAGAATTAG

Sudare191 
TAATTTGCTTTTTTTGAAGCCTTAAATCTTTTATAAACAC

Sudare192 
ACAGAATCAAATATATTTTAGTTATTTTAGAACGCG

Sudare193 
ATCATAGGTCTGAGAGACTACCTTTTTTACGTAAAA

Sudare194 
CAGAAATATTTTGGCAATTCATCAATATTTTTTAGACTTT

Sudare195 
ACAAACAATTTTAAGGTTATCTAAAATATTTTTAAGAATA

Sudare196 
CGTGGCACTTTTTACATTGGCAGATTCATTTTCTGCGCGT

Sudare197 
AACCACCATTTTGGGGAAAGCCGGCGAATTTTCGTGGACT

Sudare198 
CCAACGTCTTTTGGCAAAATCCCTTATATTTTTTCGCTAT

Sudare199 
CAAAATTAACCGCTTCTGGTGCCGTTTTCACTCCAG

Sudare200 
ATGGGATAGGTCACGTTGGTGTAGATGGGCGC

Sudare201 
TTGCTATTTTTTGCTAACGAGCGTCTTTCCAGAGCC

Sudare202 
TTCTGACCTTTTAAGGCGTTAAATAAGATTTTAAGATTAG

Sudare203 
CCGGCTTATTTTTCCAATCGCAAGACAATTTTATTTCATC

Sudare204 
TTGTTTGGTTTTTATCAAAATTATTTGCTTTTTTTAACCT

Sudare205 
CTACCTGCACTTTTAGCACTAATTTTGAGGATTTAGAAGTATTTTTAATCCTGA

Sudare206 
ACGACCAGTTTTTTCTGACCTGAAAGCGTTTTTCTTTAGG

Sudare207 
GAAAGGAATTTTAAGTGTAGCGGTCACGTTTTCCAGTCAC

Sudare208 
GAATAGCCTTTTGTCCACTATTAAAGAATTTTCGTGGCGA

Sudare209 
GCAAAGCGTTTTGATCGGTGCGGGCCTCTTTTAATCAAAA

Sudare210 
ATCGTAACTTTTGGCCTCAGGAAGATCGTTTTGAAACCAG

Sudare211 
CCTGAATCTTACCAACTTTTTTGCACCCAGCTACAA

Sudare212 
CGACCGTGTGATAAATTTTTTAAATTTAATGGTTTG

Sudare213 
TAAATGCTGATGCAAATTTTGGTTGGGTTATATAAC

Sudare214 
GGGTTAGAACCTACCATTTTATTATACTTCTGAATA

Sudare215 
AATAGATAATACATTTTTTTCAACTAATAGATTAGA

Sudare216 
AACAGAGATAGAACCCTTTTTAATAAAAGGGACATT

Sudare217 
GCGCTAGGGCGCTGGCTTTTGGGAAGAAAGCGAAAG

Sudare218 
CCAGTTTGGAACAAGATTTTCGAGATAGGGTTGAGT

Sudare219 
AACTGTTGGGAAGGGCTTTTCCATTCGCCATTCAGG

Sudare220 
GGACGACGACAGTATCTTTTCGTGCATCTGCCAGTT


Coumarin
Sudare1 
5'-GAAGGAAACCGAGGAATTTTAGATAGCCGAACAAAG-3'

Sudare2 
AGGTGGCAACATATAATTTTAACGTAGAAAATACAT

Sudare3 
CTGCACGAGTTTTTACCGTTCCAGTAAGCGTTTTGGAAAGCGCAGTCTCT

Sudare4 
GGGTTGATATAAGTATTTTTAGGCGGATAAGTGCCG

Sudare5 
CCATCGCCCACGCATATTTTGTTGCGCCGACAATGA

Sudare6 
GAGGCGCAGACGGTCATTTTCTCCATGTTACTTAGC

Sudare7 
TCAACTTTAATCATTGTTTTTTGGGCTTGAGATGGT

Sudare8 
AAAGACTTCAAATATCTTTTAAAAAGATTAAGAGGA

Sudare9 
AGAGGTCATTTTTGCGTTTTCCTTTAATTGCTCCTT

Sudare10 
GAATCGATGAACGGTATTTTTGAGAGTCTGGAGCAA

Sudare11 
AAGTAAGCTTTTACGCAATAATAACGGATTTTACGCAGTA

Sudare12 
TGTTAGCATTTTAAGAAACGCAAAGACATTTTTCATTAAA

Sudare13 
GCCAGAATTTTTTCATACATGGCTTTTGTTTTGGTTTTGC

Sudare14 
TCAGTACCTTTTAGCCCGGAATAGGTGTTTTTCAGCTTGA

Sudare15 
TACCGATATTTTACCGATATATTCGGTCTTTTCGAAATCC

Sudare16 
GCGACCTGTTTTATCATAAGGGAACCGATTTTCAGAACGA

Sudare17 
GTAGTAAATTTTTGAATTACCTTATGCGTTTTCAAAGCGG

Sudare18 
ATTGCATCTTTTGCGTTTTAATTCGAGCTTTTTCAGGATT

Sudare19 
AGAGAGTATTTTGATGGCTTAGAGCTTATTTTCTATCAGG

Sudare20 
TCATTGCCTTTTATCGTAAAACTAGCATGTCAATCA

Sudare21 
AATAGCTATCTTACCGAAGCCCTTTTTAAGAA

Sudare22 
AACAATAGATTAAGACTCCTTATTTTTTATACCCAA

Sudare23 
CTGCACGAGTTTTTGGAGTGTATTTTACAAACAAATAAATCCTTTTCCACGGAA

Sudare24 
ACTCAGGATTTTGGATTAGGATTAGCGGTTTTATGATACA

Sudare25 
TTGCAGGGTTTTAGGTGAATTTCTTAAATTTTATCACCGT

Sudare26 
ACTTTGAATTTTGCCTGATAAATTGTGTTTTTGCTGAGGC

Sudare27 
AACTGGCTTTTTCCCTGACGAGAAACACTTTTACTGACCA

Sudare28 
TACCCTGACTATTATAGTCAGAAGTTTTATTTTAAG

Sudare29 
AATGAGTGAGCAAACTCCAACAGGTTTTTTCAAAGC

Sudare30 
TATGTACCTTTTGAGAGATCTACAAAGGTTTTATTGCTGA

Sudare31 
AAGAACTGTCCTGAACAAGAAAAATTTTTGTTTATC

Sudare32 
TAAGTTTATTTTGTCACAATCAATTTTTATTGGCCT

Sudare33 
TGATATTCTTTTCTGGTAATAAGTTTTATTTTAGACTCCT

Sudare34 
CAAGAGAATTTTGGTTTAGTACCGCCACTTTTTATCAGCT

Sudare35 
TGCTTTCGTTTTAGTTAAAGGCCGCTTTTTTTGGAGATTT

Sudare36 
GTATCATCTTTTAGAGGACAGATGAACGTTTTCAGTGAAT

Sudare37 
AAGGCTTGTTTTCATTATACCAGTCAGGTTTTCAGGTCTT

Sudare38 
GAACCAGAACTCACATTAATTGCGTTTTGGGTGCCT

Sudare39 
ATATAATGCTGTAGCTCAACATGTTTTTGAGGGTAG

Sudare40 
CTATTTTTTTTTCCGGTTGATAATCAGAAAAGCCCC

Sudare41 
CATCCTAATTTTAAGAGCAAGAAACAATGAAATAGC

Sudare42 
CATATGGTTTTTTAATGCAGAACGCGCCTTTTTAATATCC

Sudare43 
CTGCACGAGTTTTTAGTGCCTTTTTTTGAGGCAGGTCAGACGTTTTAGAAAATT

Sudare44 
CCGCCACCTTTTAAGTATTAAGAGGCTGTTTTACGGGGTC

Sudare45 
CGTCACCCTTTTTTTAATTGTATCGGTTTTTTCCTCAGAA

Sudare46 
ACCAGGCGTTTTCGAAACAAAGTACAACTTTTTGCGGGAT

Sudare47 
AAGAAAAATTTTAACAAAGCTGCTCATTTTTTGTGTACAG

Sudare48 
ACTGCCCGTTTTACCATAAATCAAAAATTTTTACGTTGGG

Sudare49 
TGCAACTATTTTTAAAGTGTAAAGCCTGTTTTTTGCGCTC

Sudare50 
AAAAACAGTTTTATAAATTAATGCCGGATTTTTTTAAATA

Sudare51 
CCAATAATTTTTTTTACGAGCATGTAGATTTTAAACAACA

Sudare52 
TGTTCAGCTTTTTTACCAGCGCCAAAGATTTTAGCATTGA

Sudare53 
CAGGAGGTTTTTGAGTAACAGTGCCCGTTTTTTTATTCTG

Sudare54 
AAACATGATTTTCTCAGAACCGCCACCCTTTTGGCTCCAA

Sudare55 
AAGGAGCCTTTTTCAGCAGCGAAAGACATTTTGCGATTAT

Sudare56 
ACCAAGCGTTTTCATAGGCTGGCTGACCTTTTTTACCCAA

Sudare57 
ATCAACGTTTTTTCTACGTTAATAAAACTTTTTCAGAAAA

Sudare58 
CGAGAATGTTTTCTTTCCAGTCGGGAAATTTTATACGAGC

Sudare59 
CGGAAGCATTTTAAGTACGGTGTCTGGATTTTTCAACCGT

Sudare60 
TCTAGCTGTTTTGAAGATTGTATAAGCAAATATTTA

Sudare61 
AATAATCGTTTTTAACCCACAAGAATTGAGTTAAGC

Sudare62 
CGACATTCTTTTTCCAGACGACGACAATTTTTAACCAATC

Sudare63 
AGAACCACCACCAGAGCCGCCGCCTTTTCAAAAGGG

Sudare64 
AAACAAAACCTATTTCGGAACCTATTTTATAAACAG

Sudare65 
ACGAGGGTTTTTAAATCTCCAAAAAAAATTTTTCAGAGCC

Sudare66 
TAAAACACTCATCTTTGACCCCCATTTTGCATCGGA

Sudare67 
GTAAAAGAAAGAACCGGATATTCATTTTTTCATCAA

Sudare68 
GCCAGCTGTTTTAAATGCTTTAAACAGTTTTTGAACTAAC

Sudare69 
TCCATATATTTTCACAATTCCACACAACTTTTCCTGTCGT

Sudare70 
AATTGTAATTTTACCATCAATATGATATTTTTAGTTTCAT

Sudare71 
CAGAGAGATTTTGCTGTCTTTCCTTATCTTTTAGGTAAAG

Sudare72 
TAATTCTGTTTTAACCGATTGAGGGAGGTTTTCCGCCACC

Sudare73 
CTGCACGAGTTTTTTTAATGCCTACATTTAACAATTTCTTTTCATCAAGA

Sudare74 
ACCACCCTCATTTTCAGGGATAGCTTTTAATTTTTT

Sudare75 
CACGTTGATTTTAGCAACGGCTACAGAGTTTTGAATACAC

Sudare76 
GAGTAATCTCCATCACGCAAATTATTTTGCCACCGA

Sudare77 
GGAACAACATTATTACAGGTAGAATTTTTCATTGAA

Sudare78 
TCCCCCTCTTTTCATTAATGAATCGGCCTTTTGAAATTGT

Sudare79 
TATCCGCTTTTTACAGTTGATTCCCAATTTTTCGGAGACA

Sudare80 
GTCAAATCTTTTACGTTAATATTTTGTTAAAATTCG

Sudare81 
AACGGGTATTTTCAGAGGGTAATTGAGCGCTAATAT

Sudare82 
ATATTGACTTTTATAAAGTACCGACAAATTTTATTCCAAG

Sudare83 
CTGCACGAGTTTTTTACCTTTTTTTTGCCACCACCCTCAGAGTTTTGAAGGTAA

Sudare84 
TAGGAACCTTTTAAGATGATGAAACAAATTTTATTTGAAT

Sudare85 
GACTAAAGTTTTAGGAATTGCGAATAATTTTTAAGCCCAA

Sudare86 
AGCAATACTTTTAACGAAAGAGGCAAAATTTTGCTTTGAG

Sudare87 
CAGTTGAGTTTTTTTTATAATCAGTGAGTTTTACCGTTGT

Sudare88 
GGGAGAGGTTTTGAATCGTCATAAATATTTTTAGATTCAT

Sudare89 
CGAGTAGATTTTTAGCTGTTTCCTGTGTTTTTAACGCGCG

Sudare90 
CATTAAATTTTTAAAGGGTGAGAAAGGCTTTTTCTGCGAA

Sudare91 
AACAAAGTTTTTTTAAACCAAGTACCGCTTTTCCAGTAAT

Sudare92 
AAGAGAATTTTTGGAAATTATTCATTAATTTTAACCGCCA

Sudare93 
CCCTCAGATTTTTTAATGGAAACAGTACTTTTATTACCTG

Sudare94 
AGCAAAAGTTTTCATGTACCGTAACACTTTTTAGAAAGGA

Sudare95 
ACAACTAATTTTACTTTTTCATGAGGAATTTTGAAGGCAC

Sudare96 
CAACCTAATTTTTTCTTTGATTAGTAATTTTTGAATCCTG

Sudare97 
AGAAGTGTTTTTATTTAGGAATACCACATTTTAGCGTCCA

Sudare98 
ATACTGCGTTTTCGGTTTGCGTATTGGGTTTTTTCGTAAT

Sudare99 
CATGGTCATTTTTTTAGTTTGACCATTATTTTTGTAGGTA

Sudare100 
AAGATTCATTTTTTTTGTTAAATCAGCTCATTTTTT

Sudare101 
AGAACAAGTTTTCGGGAGAATTAACTGAACACCCTG

Sudare102 
TATCACCGTTTTCAGAGGCATTTTCGAGTTTTACTCATCG

Sudare103 
CTGCACGAGTTTTTATATATGTTTTTGAGCCGCCACCCTCAGTTTTAGGTGAAT

Sudare104 
TCACCAGTTTTTCGAATTATTCATTTCATTTTATAAATCA

Sudare105 
CAACAGTTTCAGCGGAGTGAGAATTTTTGAGTTTCG

Sudare106 
ATTAACACTACGTAATGCCACTACTTTTGTTTCCAT

Sudare107 
ATGCAGATTTTTCAGGAACGGTACGCCATTTTAACATCAC

Sudare108 
TGGTTTTTTTTTAATGTTTAGACTGGATTTTTTTCAACTA

Sudare109 
TCGCAAATTTTTGGGTACCGAGCTCGAATTTTCGCCAGGG

Sudare110 
AACCAATATTTTCAATGCCTGAGTAATGTTTTGATACATT

Sudare111 
GCATTAGATTTTCAAGCCGTTTTTATTTTTTTCAACATGT

Sudare112 
AATTTAGGTTTTTCACCGACTTGAGCCATTTTGGAACCGC

Sudare113 
CTCCCTCATTTTGAGTGAATAACCTTGCTTTTCAAAATCG

Sudare114 
CGCAGAGGTTTTACAAACTACAACGCCTTTTTACAACTTT

Sudare115 
TAAACGGGGCAACAGTGCCACGCTTTTTCGGTCAGT

Sudare116 
TTGCCTGAGTAGAAGAACTCAAACTTTTTTAAAGGG

Sudare117 
ATTTTAGATTTTACATAACGCCAAAAGGTTTTGAGGGGGT

Sudare118 
AATAGTAATTTTCTTTTCACCAGTGAGATTTTACTCTAGA

Sudare119 
GGATCCCCTTTTGGTCAATAACCTGTTTTTTTTCATATAT

Sudare120 
TTTAAATGTTTTGGAACGCCATCAAAAATAATTCGC

Sudare121 
GGAATCATTTTTAGAATAACATAAAAACAGGGAAGC

Sudare122 
TTAGAGCCTTTTCCATATTTAACAACGCTTTTTCATCGTA

Sudare123 
CTGCACGAGTTTTTATCGTCGCTTTTAACCAGAGCCACCACCTTTTTTTGGGAA

Sudare124 
CCACAGACTTTTTTTGAATACCAAGTTATTTTTTCTGTAA

Sudare125 
GCAGCAAATTTTTATGGGATTTTGCTAATTTTGTAGCATT

Sudare126 
TTGCTGGTTTTTTAAAACAGAGGTGAGGTTTTGAGAGCCA

Sudare127 
GGCATAGTTTTTCTAAACAGGAGGCCGATTTTTATCGGCC

Sudare128 
AGCTGATTTTTTAAAAGAAGTTTTGCCATTTTAATTACGA

Sudare129 
TTTCATTTTTTTGCATGCCTGCAGGTCGTTTTCGGGCAAC

Sudare130 
GTCTGGCCTTTTAAAATTTTTAGAACCCTTTTAGCTATAT

Sudare131 
TTACAGAGTTTTTACCGCGCCCAATAGCTTTTGCTTAATT

Sudare132 
GAGAATCGTTTTAGCAAAATCACCAGTATTTTTAATCAAA

Sudare133 
ATCACCGGTTTTTATTAATTAATTTTCCTTTTGGATTCGC

Sudare134 
CTGATTGCTTTTAGCCCTCATAGTTAGCTTTTGTAAATGA

Sudare135 
ATTTTCTGTTTTTGAAAAATCTAAAGCATTTTAACCACCA

Sudare136 
GCAGAAGATTTTAATATCCAGAACAATATTTTAGAATCAG

Sudare137 
AGCGGGAGTTTTAAGAGCAACACTATCATTTTAGCGAGAG

Sudare138 
GCTTTTGCTTTTGCCCTTCACCGCCTGGTTTTGGCCAGTG

Sudare139 
CCAAGCTTTTTTGGGGCGCGAGCTGAAATTTTTTTCAACG

Sudare140 
CAAGGATATTTTTTCCTGTAGCCAGCTTTCATCAAC

Sudare141 
CAGATATATTTTCGTCAAAAATGAAAATAGCAGCCT

Sudare142 
ACCATTAGTTTTAACGCTCAACAGTAGGTTTTAAGCAAAT

Sudare143 
CTGCACGAGTTTTTCCTTGAAATTTTGTTTGCCATCTTTTCATTTTGCACCATT

Sudare144 
TTTTACATCGGGAGAAACAATAACTTTTCTTAGAAT

Sudare145 
TAACATTAGTCTTTCCAGACGTTATTTTGTAACGAT

Sudare146 
AGCCATTGTTTTTTAAAAATACCGAACGTTTTTCACCTTG

Sudare147 
CACGTATAACGTGCTTTCCTCGTTTTTTTTACCGCC

Sudare148 
ATCAAGTTCGATAAAAACCAAAATTTTTTAACCCTC

Sudare149 
TCAATTCTTTTTGACGTTGTAAAACGACTTTTCCCTGAGA

Sudare150 
ATTAAATGTTTTGCGGGAGAAGCCTTTATTTTAGGTGGCA

Sudare151 
TTGTTTAATTTTGAAGGCTTATCCGGTATTTTTTACCAGT

Sudare152 
ATAAAGCCTTTTCAAGGCCGGAAACGTCTTTTTAGCCCCC

Sudare153 
TTATTAGCTTTTACATAGCGATAGCTTATTTTACAGTACC

Sudare154 
CTAAAGTTTTGCGGAACAAAGAAATTTTAGTTTGAG

Sudare155 
CTGAACCTCAAATATCAAACCCTCTTTTCCCTAAAA

Sudare156 
CATCGCCATTTTCAACAGGAAAAACGCTTTTTTTGACGAG

Sudare157 
GTTTACCAGGGTCGAGGTGCCGTATTTTTCACCCAA

Sudare158 
GAGTTGCAGCAAGCGGTCCACGCTTTTTGGGTTTTC

Sudare159 
CCAGTCACTTTTACTAATAGTAGTAGCATTTTACCCTGTA

Sudare160 
ATACTTTTTTTTTGAGCGAGTAACAACCCGTCGGAT

Sudare161 
ACGCGAGGTTTTCCAATCCAAATAAGAAACGATTTT

Sudare162 
AACCATCGTTTTTGCGTTATACAAATTCTTTTTTCTAAGA

Sudare163 
CTGCACGAGTTTTTCGCTGAGATTTTTCGGCATTTTCGGTCATTTTACCAATGA

Sudare164 
AGGAGCGGTTTTAGATGAATATACAGTATTTTGATTAAGA

Sudare165 
TCTGGTCATTTTCGTTATTAATTTTAAATTTTCCACCAGA

Sudare166 
TACCTACATTTTATGCGCGAACTGATAGTTTTAATCAATA

Sudare167 
AATCGGAATTTTGCGTACTATGGTTGCTTTTTCATGGAAA

Sudare168 
CCAGCAGGTTTTCCCACTACGTGAACCATTTTAAGCACTA

Sudare169 
CAATAAATTTTTAAGTTGGGTAACGCCATTTTGGTTTGCC

Sudare170 
TCTCCGTGTTTTTACCAAAAACATTATGTTTTTTAACATC

Sudare171 
TATTTATCTTTTCGTTTTAGCGAACCTCTTTTCCTGTTTA

Sudare172 
GTATCATATTTTATAGCAGCACCGTAATTTTTCTGTAGCG

Sudare173 
CGTTTTCATTTTAGAGTCAATAGTGAATTTTTTTTCAGGT

Sudare174 
TTAACGTCTTTTAATTATCATCATATTCTTTTAAATCCTT

Sudare175 
TGCCCGAATTTTGTTGGCAAATCAACAGTTTTTGGCTATT

Sudare176 
AGTCTTTATTTTTTTTGACGCTCAATCGTTTTTGCGCCGC

Sudare177 
TACAGGGCTTTTCCCTAAAGGGAGCCCCTTTTTCTATCAG

Sudare178 
GGCGATGGTTTTCGAAAATCCTGTTTGATTTTGTGCTGCA

Sudare179 
AGGCGATTTTTTCATACAGGCAAGGCAATTTTAAAGCTAA

Sudare180 
ATCGGTTGTTTTGGAACAAACGGCGGATTGACCGTA

Sudare181 
CGGGAGGTTTTTCAGTTACAAAATAAACAGCCATAT

Sudare182 
CGGAATCATAATTACTAGAAAAAGTTTTCCGACTTG

Sudare183 
AGAAAACTTGCCTTTAGCGTCAGATTTTCAGTAGCG

Sudare184 
CAGATGATTTTTAAGAAATTGCGTAGATTTTTTTATCAAA

Sudare185 
AATTGAGGTTTTTTCGACAACTCGTATTTTTTCTGATTAT

Sudare186 
GGATTATTTTTTAGACAATATTTTTGAATTTTTTGAAAGG

Sudare187 
AGCTTGACTTTTCACCCGCCGCGCTTAATTTTTCTGAAAT

Sudare188 
CCGAAATCTTTTAAAGGGCGAAAAACCGTTTTCGATTTAG

Sudare189 
TACGCCAGCTGGCGAAAGGGGGATTTTTTGGTGGTT

Sudare190 
CCAGCTTTTAAAGCCTCAGAGCATTTTTAGAATTAG

Sudare191 
TAATTTGCTTTTTTTGAAGCCTTAAATCTTTTATAAACAC

Sudare192 
ACAGAATCAAATATATTTTAGTTATTTTAGAACGCG

Sudare193 
CTGCACGAGTTTTTATCATAGGTCTGAGAGACTACCTTTTTTACGTAAAA

Sudare194 
CAGAAATATTTTGGCAATTCATCAATATTTTTTAGACTTT

Sudare195 
ACAAACAATTTTAAGGTTATCTAAAATATTTTTAAGAATA

Sudare196 
CGTGGCACTTTTTACATTGGCAGATTCATTTTCTGCGCGT

Sudare197 
AACCACCATTTTGGGGAAAGCCGGCGAATTTTCGTGGACT

Sudare198 
CCAACGTCTTTTGGCAAAATCCCTTATATTTTTTCGCTAT

Sudare199 
CAAAATTAACCGCTTCTGGTGCCGTTTTCACTCCAG

Sudare200 
ATGGGATAGGTCACGTTGGTGTAGATGGGCGC

Sudare201 
TTGCTATTTTTTGCTAACGAGCGTCTTTCCAGAGCC

Sudare202 
TTCTGACCTTTTAAGGCGTTAAATAAGATTTTAAGATTAG

Sudare203 
CTGCACGAGTTTTTCCGGCTTATTTTTCCAATCGCAAGACAATTTTATTTCATC

Sudare204 
TTGTTTGGTTTTTATCAAAATTATTTGCTTTTTTTAACCT

Sudare205 
AGCACTAATTTTGAGGATTTAGAAGTATTTTTAATCCTGA

Sudare206 
ACGACCAGTTTTTTCTGACCTGAAAGCGTTTTTCTTTAGG

Sudare207 
GAAAGGAATTTTAAGTGTAGCGGTCACGTTTTCCAGTCAC

Sudare208 
GAATAGCCTTTTGTCCACTATTAAAGAATTTTCGTGGCGA

Sudare209 
GCAAAGCGTTTTGATCGGTGCGGGCCTCTTTTAATCAAAA

Sudare210 
ATCGTAACTTTTGGCCTCAGGAAGATCGTTTTGAAACCAG

Sudare211 
CCTGAATCTTACCAACTTTTTTGCACCCAGCTACAA

Sudare212 
CGACCGTGTGATAAATTTTTTAAATTTAATGGTTTG

Sudare213 
TAAATGCTGATGCAAATTTTGGTTGGGTTATATAAC

Sudare214 
GGGTTAGAACCTACCATTTTATTATACTTCTGAATA

Sudare215 
AATAGATAATACATTTTTTTCAACTAATAGATTAGA

Sudare216 
AACAGAGATAGAACCCTTTTTAATAAAAGGGACATT

Sudare217 
GCGCTAGGGCGCTGGCTTTTGGGAAGAAAGCGAAAG

Sudare218 
CCAGTTTGGAACAAGATTTTCGAGATAGGGTTGAGT

Sudare219 
AACTGTTGGGAAGGGCTTTTCCATTCGCCATTCAGG

Sudare220 
GGACGACGACAGTATCTTTTCGTGCATCTGCCAGTT


Tricolor
Sudare1 
5'-CACGAAAGCCTTTTGAAGGAAACCGAGGAATTTTAGATAGCCGAACAAAG-3'

Sudare2 
AGGTGGCAACATATAATTTTAACGTAGAAAATACAT

Sudare3 
CTGCACGAGTTTTTACCGTTCCAGTAAGCGTTTTGGAAAGCGCAGTCTCT

Sudare4 
GGGTTGATATAAGTATTTTTAGGCGGATAAGTGCCG

Sudare5 
CTACCTGCACTTTTCCATCGCCCACGCATATTTTGTTGCGCCGACAATGA

Sudare6 
GAGGCGCAGACGGTCATTTTCTCCATGTTACTTAGC

Sudare7 
TCAACTTTAATCATTGTTTTTTGGGCTTGAGATGGT

Sudare8 
AAAGACTTCAAATATCTTTTAAAAAGATTAAGAGGA

Sudare9 
AGAGGTCATTTTTGCGTTTTCCTTTAATTGCTCCTT

Sudare10 
GAATCGATGAACGGTATTTTTGAGAGTCTGGAGCAA

Sudare11 
AAGTAAGCTTTTACGCAATAATAACGGATTTTACGCAGTA

Sudare12 
TGTTAGCATTTTAAGAAACGCAAAGACATTTTTCATTAAA

Sudare13 
GCCAGAATTTTTTCATACATGGCTTTTGTTTTGGTTTTGC

Sudare14 
TCAGTACCTTTTAGCCCGGAATAGGTGTTTTTCAGCTTGA

Sudare15 
TACCGATATTTTACCGATATATTCGGTCTTTTCGAAATCC

Sudare16 
GCGACCTGTTTTATCATAAGGGAACCGATTTTCAGAACGA

Sudare17 
GTAGTAAATTTTTGAATTACCTTATGCGTTTTCAAAGCGG

Sudare18 
ATTGCATCTTTTGCGTTTTAATTCGAGCTTTTTCAGGATT

Sudare19 
AGAGAGTATTTTGATGGCTTAGAGCTTATTTTCTATCAGG

Sudare20 
TCATTGCCTTTTATCGTAAAACTAGCATGTCAATCA

Sudare21 
CACGAAAGCCTTTTAATAGCTATCTTACCGAAGCCCTTTTTAAGAA

Sudare22 
AACAATAGATTAAGACTCCTTATTTTTTATACCCAA

Sudare23 
CTGCACGAGTTTTTGGAGTGTATTTTACAAACAAATAAATCCTTTTCCACGGAA

Sudare24 
ACTCAGGATTTTGGATTAGGATTAGCGGTTTTATGATACA

Sudare25 
CTACCTGCACTTTTTTGCAGGGTTTTAGGTGAATTTCTTAAATTTTATCACCGT

Sudare26 
ACTTTGAATTTTGCCTGATAAATTGTGTTTTTGCTGAGGC

Sudare27 
AACTGGCTTTTTCCCTGACGAGAAACACTTTTACTGACCA

Sudare28 
TACCCTGACTATTATAGTCAGAAGTTTTATTTTAAG

Sudare29 
AATGAGTGAGCAAACTCCAACAGGTTTTTTCAAAGC

Sudare30 
TATGTACCTTTTGAGAGATCTACAAAGGTTTTATTGCTGA

Sudare31 
AAGAACTGTCCTGAACAAGAAAAATTTTTGTTTATC

Sudare32 
TAAGTTTATTTTGTCACAATCAATTTTTATTGGCCT

Sudare33 
TGATATTCTTTTCTGGTAATAAGTTTTATTTTAGACTCCT

Sudare34 
CAAGAGAATTTTGGTTTAGTACCGCCACTTTTTATCAGCT

Sudare35 
TGCTTTCGTTTTAGTTAAAGGCCGCTTTTTTTGGAGATTT

Sudare36 
GTATCATCTTTTAGAGGACAGATGAACGTTTTCAGTGAAT

Sudare37 
AAGGCTTGTTTTCATTATACCAGTCAGGTTTTCAGGTCTT

Sudare38 
GAACCAGAACTCACATTAATTGCGTTTTGGGTGCCT

Sudare39 
ATATAATGCTGTAGCTCAACATGTTTTTGAGGGTAG

Sudare40 
CTATTTTTTTTTCCGGTTGATAATCAGAAAAGCCCC

Sudare41 
CACGAAAGCCTTTTCATCCTAATTTTAAGAGCAAGAAACAATGAAATAGC

Sudare42 
CATATGGTTTTTTAATGCAGAACGCGCCTTTTTAATATCC

Sudare43 
CTGCACGAGTTTTTAGTGCCTTTTTTTGAGGCAGGTCAGACGTTTTAGAAAATT

Sudare44 
CCGCCACCTTTTAAGTATTAAGAGGCTGTTTTACGGGGTC

Sudare45 
CTACCTGCACTTTTCGTCACCCTTTTTTTAATTGTATCGGTTTTTTCCTCAGAA

Sudare46 
ACCAGGCGTTTTCGAAACAAAGTACAACTTTTTGCGGGAT

Sudare47 
AAGAAAAATTTTAACAAAGCTGCTCATTTTTTGTGTACAG

Sudare48 
ACTGCCCGTTTTACCATAAATCAAAAATTTTTACGTTGGG

Sudare49 
TGCAACTATTTTTAAAGTGTAAAGCCTGTTTTTTGCGCTC

Sudare50 
AAAAACAGTTTTATAAATTAATGCCGGATTTTTTTAAATA

Sudare51 
CCAATAATTTTTTTTACGAGCATGTAGATTTTAAACAACA

Sudare52 
TGTTCAGCTTTTTTACCAGCGCCAAAGATTTTAGCATTGA

Sudare53 
CAGGAGGTTTTTGAGTAACAGTGCCCGTTTTTTTATTCTG

Sudare54 
AAACATGATTTTCTCAGAACCGCCACCCTTTTGGCTCCAA

Sudare55 
AAGGAGCCTTTTTCAGCAGCGAAAGACATTTTGCGATTAT

Sudare56 
ACCAAGCGTTTTCATAGGCTGGCTGACCTTTTTTACCCAA

Sudare57 
ATCAACGTTTTTTCTACGTTAATAAAACTTTTTCAGAAAA

Sudare58 
CGAGAATGTTTTCTTTCCAGTCGGGAAATTTTATACGAGC

Sudare59 
CGGAAGCATTTTAAGTACGGTGTCTGGATTTTTCAACCGT

Sudare60 
TCTAGCTGTTTTGAAGATTGTATAAGCAAATATTTA

Sudare61 
CACGAAAGCCTTTTAATAATCGTTTTTAACCCACAAGAATTGAGTTAAGC

Sudare62 
CGACATTCTTTTTCCAGACGACGACAATTTTTAACCAATC

Sudare63 
AGAACCACCACCAGAGCCGCCGCCTTTTCAAAAGGG

Sudare64 
AAACAAAACCTATTTCGGAACCTATTTTATAAACAG

Sudare65 
CTACCTGCACTTTTACGAGGGTTTTTAAATCTCCAAAAAAAATTTTTCAGAGCC

Sudare66 
TAAAACACTCATCTTTGACCCCCATTTTGCATCGGA

Sudare67 
GTAAAAGAAAGAACCGGATATTCATTTTTTCATCAA

Sudare68 
GCCAGCTGTTTTAAATGCTTTAAACAGTTTTTGAACTAAC

Sudare69 
TCCATATATTTTCACAATTCCACACAACTTTTCCTGTCGT

Sudare70 
AATTGTAATTTTACCATCAATATGATATTTTTAGTTTCAT

Sudare71 
CAGAGAGATTTTGCTGTCTTTCCTTATCTTTTAGGTAAAG

Sudare72 
TAATTCTGTTTTAACCGATTGAGGGAGGTTTTCCGCCACC

Sudare73 
CTGCACGAGTTTTTTTAATGCCTACATTTAACAATTTCTTTTCATCAAGA

Sudare74 
ACCACCCTCATTTTCAGGGATAGCTTTTAATTTTTT

Sudare75 
CACGTTGATTTTAGCAACGGCTACAGAGTTTTGAATACAC

Sudare76 
GAGTAATCTCCATCACGCAAATTATTTTGCCACCGA

Sudare77 
GGAACAACATTATTACAGGTAGAATTTTTCATTGAA

Sudare78 
TCCCCCTCTTTTCATTAATGAATCGGCCTTTTGAAATTGT

Sudare79 
TATCCGCTTTTTACAGTTGATTCCCAATTTTTCGGAGACA

Sudare80 
GTCAAATCTTTTACGTTAATATTTTGTTAAAATTCG

Sudare81 
CACGAAAGCCTTTTAACGGGTATTTTCAGAGGGTAATTGAGCGCTAATAT

Sudare82 
ATATTGACTTTTATAAAGTACCGACAAATTTTATTCCAAG

Sudare83 
CTG CAC GAG TTTTTTACCTTTTTTTTGCCACCACCCTCAGAGTTTTGAAGGTAA

Sudare84 
TAGGAACCTTTTAAGATGATGAAACAAATTTTATTTGAAT

Sudare85 
CTACCTGCACTTTTGACTAAAGTTTTAGGAATTGCGAATAATTTTTAAGCCCAA

Sudare86 
AGCAATACTTTTAACGAAAGAGGCAAAATTTTGCTTTGAG

Sudare87 
CAGTTGAGTTTTTTTTATAATCAGTGAGTTTTACCGTTGT

Sudare88 
GGGAGAGGTTTTGAATCGTCATAAATATTTTTAGATTCAT

Sudare89 
CGAGTAGATTTTTAGCTGTTTCCTGTGTTTTTAACGCGCG

Sudare90 
CATTAAATTTTTAAAGGGTGAGAAAGGCTTTTTCTGCGAA

Sudare91 
AACAAAGTTTTTTTAAACCAAGTACCGCTTTTCCAGTAAT

Sudare92 
AAGAGAATTTTTGGAAATTATTCATTAATTTTAACCGCCA

Sudare93 
CCCTCAGATTTTTTAATGGAAACAGTACTTTTATTACCTG

Sudare94 
AGCAAAAGTTTTCATGTACCGTAACACTTTTTAGAAAGGA

Sudare95 
ACAACTAATTTTACTTTTTCATGAGGAATTTTGAAGGCAC

Sudare96 
CAACCTAATTTTTTCTTTGATTAGTAATTTTTGAATCCTG

Sudare97 
AGAAGTGTTTTTATTTAGGAATACCACATTTTAGCGTCCA

Sudare98 
ATACTGCGTTTTCGGTTTGCGTATTGGGTTTTTTCGTAAT

Sudare99 
CATGGTCATTTTTTTAGTTTGACCATTATTTTTGTAGGTA

Sudare100 
AAGATTCATTTTTTTTGTTAAATCAGCTCATTTTTT

Sudare101 
CACGAAAGCCTTTTAGAACAAGTTTTCGGGAGAATTAACTGAACACCCTG

Sudare102 
TATCACCGTTTTCAGAGGCATTTTCGAGTTTTACTCATCG

Sudare103 
CTGCACGAGTTTTTATATATGTTTTTGAGCCGCCACCCTCAGTTTTAGGTGAAT

Sudare104 
TCACCAGTTTTTCGAATTATTCATTTCATTTTATAAATCA

Sudare105 
CAACAGTTTCAGCGGAGTGAGAATTTTTGAGTTTCG

Sudare106 
ATTAACACTACGTAATGCCACTACTTTTGTTTCCAT

Sudare107 
ATGCAGATTTTTCAGGAACGGTACGCCATTTTAACATCAC

Sudare108 
TGGTTTTTTTTTAATGTTTAGACTGGATTTTTTTCAACTA

Sudare109 
TCGCAAATTTTTGGGTACCGAGCTCGAATTTTCGCCAGGG

Sudare110 
AACCAATATTTTCAATGCCTGAGTAATGTTTTGATACATT

Sudare111 
GCATTAGATTTTCAAGCCGTTTTTATTTTTTTCAACATGT

Sudare112 
AATTTAGGTTTTTCACCGACTTGAGCCATTTTGGAACCGC

Sudare113 
CTCCCTCATTTTGAGTGAATAACCTTGCTTTTCAAAATCG

Sudare114 
CGCAGAGGTTTTACAAACTACAACGCCTTTTTACAACTTT

Sudare115 
CTACCTGCACTTTTTAAACGGGGCAACAGTGCCACGCTTTTTCGGTCAGT

Sudare116 
TTGCCTGAGTAGAAGAACTCAAACTTTTTTAAAGGG

Sudare117 
ATTTTAGATTTTACATAACGCCAAAAGGTTTTGAGGGGGT

Sudare118 
AATAGTAATTTTCTTTTCACCAGTGAGATTTTACTCTAGA

Sudare119 
GGATCCCCTTTTGGTCAATAACCTGTTTTTTTTCATATAT

Sudare120 
TTTAAATGTTTTGGAACGCCATCAAAAATAATTCGC

Sudare121 
CACGAAAGCCTTTTGGAATCATTTTTAGAATAACATAAAAACAGGGAAGC

Sudare122 
TTAGAGCCTTTTCCATATTTAACAACGCTTTTTCATCGTA

Sudare123 
CTGCACGAGTTTTTATCGTCGCTTTTAACCAGAGCCACCACCTTTTTTTGGGAA

Sudare124 
CCACAGACTTTTTTTGAATACCAAGTTATTTTTTCTGTAA

Sudare125 
CTACCTGCACTTTTGCAGCAAATTTTTATGGGATTTTGCTAATTTTGTAGCATT

Sudare126 
TTGCTGGTTTTTTAAAACAGAGGTGAGGTTTTGAGAGCCA

Sudare127 
GGCATAGTTTTTCTAAACAGGAGGCCGATTTTTATCGGCC

Sudare128 
AGCTGATTTTTTAAAAGAAGTTTTGCCATTTTAATTACGA

Sudare129 
TTTCATTTTTTTGCATGCCTGCAGGTCGTTTTCGGGCAAC

Sudare130 
GTCTGGCCTTTTAAAATTTTTAGAACCCTTTTAGCTATAT

Sudare131 
TTACAGAGTTTTTACCGCGCCCAATAGCTTTTGCTTAATT

Sudare132 
GAGAATCGTTTTAGCAAAATCACCAGTATTTTTAATCAAA

Sudare133 
ATCACCGGTTTTTATTAATTAATTTTCCTTTTGGATTCGC

Sudare134 
CTGATTGCTTTTAGCCCTCATAGTTAGCTTTTGTAAATGA

Sudare135 
CTACCTGCACTTTTATTTTCTGTTTTTGAAAAATCTAAAGCATTTTAACCACCA

Sudare136 
GCAGAAGATTTTAATATCCAGAACAATATTTTAGAATCAG

Sudare137 
AGCGGGAGTTTTAAGAGCAACACTATCATTTTAGCGAGAG

Sudare138 
GCTTTTGCTTTTGCCCTTCACCGCCTGGTTTTGGCCAGTG

Sudare139 
CCAAGCTTTTTTGGGGCGCGAGCTGAAATTTTTTTCAACG

Sudare140 
CAAGGATATTTTTTCCTGTAGCCAGCTTTCATCAAC

Sudare141 
CACGAAAGCCTTTTCAGATATATTTTCGTCAAAAATGAAAATAGCAGCCT

Sudare142 
ACCATTAGTTTTAACGCTCAACAGTAGGTTTTAAGCAAAT

Sudare143 
CTGCACGAGTTTTTCCTTGAAATTTTGTTTGCCATCTTTTCATTTTGCACCATT

Sudare144 
TTTTACATCGGGAGAAACAATAACTTTTCTTAGAAT

Sudare145 
TAACATTAGTCTTTCCAGACGTTATTTTGTAACGAT

Sudare146 
AGCCATTGTTTTTTAAAAATACCGAACGTTTTTCACCTTG

Sudare147 
CACGTATAACGTGCTTTCCTCGTTTTTTTTACCGCC

Sudare148 
ATCAAGTTCGATAAAAACCAAAATTTTTTAACCCTC

Sudare149 
TCAATTCTTTTTGACGTTGTAAAACGACTTTTCCCTGAGA

Sudare150 
ATTAAATGTTTTGCGGGAGAAGCCTTTATTTTAGGTGGCA

Sudare151 
TTGTTTAATTTTGAAGGCTTATCCGGTATTTTTTACCAGT

Sudare152 
ATAAAGCCTTTTCAAGGCCGGAAACGTCTTTTTAGCCCCC

Sudare153 
TTATTAGCTTTTACATAGCGATAGCTTATTTTACAGTACC

Sudare154 
CTAAAGTTTTGCGGAACAAAGAAATTTTAGTTTGAG

Sudare155 
CTGAACCTCAAATATCAAACCCTCTTTTCCCTAAAA

Sudare156 
CATCGCCATTTTCAACAGGAAAAACGCTTTTTTTGACGAG

Sudare157 
GTTTACCAGGGTCGAGGTGCCGTATTTTTCACCCAA

Sudare158 
GAGTTGCAGCAAGCGGTCCACGCTTTTTGGGTTTTC

Sudare159 
CCAGTCACTTTTACTAATAGTAGTAGCATTTTACCCTGTA

Sudare160 
ATACTTTTTTTTTGAGCGAGTAACAACCCGTCGGAT

Sudare161 
CACGAAAGCCTTTTACGCGAGGTTTTCCAATCCAAATAAGAAACGATTTT

Sudare162 
AACCATCGTTTTTGCGTTATACAAATTCTTTTTTCTAAGA

Sudare163 
CTGCACGAGTTTTTCGCTGAGATTTTTCGGCATTTTCGGTCATTTTACCAATGA

Sudare164 
AGGAGCGGTTTTAGATGAATATACAGTATTTTGATTAAGA

Sudare165 
CTACCTGCACTTTTTCTGGTCATTTTCGTTATTAATTTTAAATTTTCCACCAGA

Sudare166 
TACCTACATTTTATGCGCGAACTGATAGTTTTAATCAATA

Sudare167 
AATCGGAATTTTGCGTACTATGGTTGCTTTTTCATGGAAA

Sudare168 
CCAGCAGGTTTTCCCACTACGTGAACCATTTTAAGCACTA

Sudare169 
CAATAAATTTTTAAGTTGGGTAACGCCATTTTGGTTTGCC

Sudare170 
TCTCCGTGTTTTTACCAAAAACATTATGTTTTTTAACATC

Sudare171 
TATTTATCTTTTCGTTTTAGCGAACCTCTTTTCCTGTTTA

Sudare172 
GTATCATATTTTATAGCAGCACCGTAATTTTTCTGTAGCG

Sudare173 
CGTTTTCATTTTAGAGTCAATAGTGAATTTTTTTTCAGGT

Sudare174 
TTAACGTCTTTTAATTATCATCATATTCTTTTAAATCCTT

Sudare175 
TGCCCGAATTTTGTTGGCAAATCAACAGTTTTTGGCTATT

Sudare176 
AGTCTTTATTTTTTTTGACGCTCAATCGTTTTTGCGCCGC

Sudare177 
TACAGGGCTTTTCCCTAAAGGGAGCCCCTTTTTCTATCAG

Sudare178 
GGCGATGGTTTTCGAAAATCCTGTTTGATTTTGTGCTGCA

Sudare179 
AGGCGATTTTTTCATACAGGCAAGGCAATTTTAAAGCTAA

Sudare180 
ATCGGTTGTTTTGGAACAAACGGCGGATTGACCGTA

Sudare181 
CACGAAAGCCTTTTCGGGAGGTTTTTCAGTTACAAAATAAACAGCCATAT

Sudare182 
CGGAATCATAATTACTAGAAAAAGTTTTCCGACTTG

Sudare183 
AGAAAACTTGCCTTTAGCGTCAGATTTTCAGTAGCG

Sudare184 
CAGATGATTTTTAAGAAATTGCGTAGATTTTTTTATCAAA

Sudare185 
CTACCTGCACTTTTAATTGAGGTTTTTTCGACAACTCGTATTTTTTCTGATTAT

Sudare186 
GGATTATTTTTTAGACAATATTTTTGAATTTTTTGAAAGG

Sudare187 
AGCTTGACTTTTCACCCGCCGCGCTTAATTTTTCTGAAAT

Sudare188 
CCGAAATCTTTTAAAGGGCGAAAAACCGTTTTCGATTTAG

Sudare189 
TACGCCAGCTGGCGAAAGGGGGATTTTTTGGTGGTT

Sudare190 
CCAGCTTTTAAAGCCTCAGAGCATTTTTAGAATTAG

Sudare191 
TAATTTGCTTTTTTTGAAGCCTTAAATCTTTTATAAACAC

Sudare192 
ACAGAATCAAATATATTTTAGTTATTTTAGAACGCG

Sudare193 
CTGCACGAGTTTTTATCATAGGTCTGAGAGACTACCTTTTTTACGTAAAA

Sudare194 
CAGAAATATTTTGGCAATTCATCAATATTTTTTAGACTTT

Sudare195 
ACAAACAATTTTAAGGTTATCTAAAATATTTTTAAGAATA

Sudare196 
CGTGGCACTTTTTACATTGGCAGATTCATTTTCTGCGCGT

Sudare197 
AACCACCATTTTGGGGAAAGCCGGCGAATTTTCGTGGACT

Sudare198 
CCAACGTCTTTTGGCAAAATCCCTTATATTTTTTCGCTAT

Sudare199 
CAAAATTAACCGCTTCTGGTGCCGTTTTCACTCCAG

Sudare200 
ATGGGATAGGTCACGTTGGTGTAGATGGGCGC

Sudare201 
CACGAAAGCCTTTTTTGCTATTTTTTGCTAACGAGCGTCTTTCCAGAGCC

Sudare202 
TTCTGACCTTTTAAGGCGTTAAATAAGATTTTAAGATTAG

Sudare203 
CTGCACGAGTTTTTCCGGCTTATTTTTCCAATCGCAAGACAATTTTATTTCATC

Sudare204 
TTGTTTGGTTTTTATCAAAATTATTTGCTTTTTTTAACCT

Sudare205 
CTACCTGCACTTTTAGCACTAATTTTGAGGATTTAGAAGTATTTTTAATCCTGA

Sudare206 
ACGACCAGTTTTTTCTGACCTGAAAGCGTTTTTCTTTAGG

Sudare207 
GAAAGGAATTTTAAGTGTAGCGGTCACGTTTTCCAGTCAC

Sudare208 
GAATAGCCTTTTGTCCACTATTAAAGAATTTTCGTGGCGA

Sudare209 
GCAAAGCGTTTTGATCGGTGCGGGCCTCTTTTAATCAAAA

Sudare210 
ATCGTAACTTTTGGCCTCAGGAAGATCGTTTTGAAACCAG

Sudare211 
CCTGAATCTTACCAACTTTTTTGCACCCAGCTACAA

Sudare212 
CGACCGTGTGATAAATTTTTTAAATTTAATGGTTTG

Sudare213 
TAAATGCTGATGCAAATTTTGGTTGGGTTATATAAC

Sudare214 
GGGTTAGAACCTACCATTTTATTATACTTCTGAATA

Sudare215 
AATAGATAATACATTTTTTTCAACTAATAGATTAGA

Sudare216 
AACAGAGATAGAACCCTTTTTAATAAAAGGGACATT

Sudare217 
GCGCTAGGGCGCTGGCTTTTGGGAAGAAAGCGAAAG

Sudare218 
CCAGTTTGGAACAAGATTTTCGAGATAGGGTTGAGT

Sudare219 
AACTGTTGGGAAGGGCTTTTCCATTCGCCATTCAGG

Sudare220 
GGACGACGACAGTATCTTTTCGTGCATCTGCCAGTT









Team Name: Team Kansai
Institution Name: Kansai University
Geographic Location: Osaka, Japan